General Information
Symbol
Dmel\Dys-RA
Species
D. melanogaster
Annotation Symbol
CG34157-RA
FlyBase ID
FBtr0083764
Feature type
Associated gene
Evidence Rank
Length (nt)
11661
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 32 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          AGATCGCTTTCTGACTTCGAAGCGTAAAGACTTAAAACGCGTCGGATAAACACCATGATGTTACTGGTTTTTTTCTGCGC
          GCCGTCGTTGTGAGCCGAGAAGAAAAAGTCTTTGTAGAATTCTTGGCACACCTTCGATTTCTGGAAATTAACGCGAAATA
          TTACGAAACGAAGCGGTAAACAAAACCAAATGGTGCGAAAGTGGTAAAAAAAAACGAAATGCGGCGATATCAGTTGTCTT
          ACCACGAAGCATACATATCAATCAAACCGAAATAAATAACCCGAATTGTGTCCATGTGATTCAACGATTTTGTAATTCAA
          TTCGATACGATACGACCTTGAAAAGCATAGGTTTTTATGTTGGTGATTTTAAATTTTATCGAAACGAAATCAATTCGCTA
          CTGGGATTAAGCGAATCAAGGATTATACGACTATGGAACCCGGAATTTTAATTGATGAAAGACAGCACATACAGAAGAAA
          ACATTCACAAAATGGATCAATTCACATCTTATCGATACCCAGTGTACACCAGTGAAGGATTTGTTCTTGGACCTGCGGGA
          CGGACATCGATTGCTTGCCCTGCTGAGCACGCTGACTCAAACCAACCTGAAACCCGAAAAAGGCCGAATGCGAGTGCACC
          ACATAAACAATCTGAACAAGGTGATTACCGAGATCCAGCAGCATGGTGTCAAGTTGGTGAACATCTCCAGCGATGACATA
          GTGGGTGGCAATGCCAAGTTGACCCTAGGCCTCATATGGCTGATAGCGCTGGAGTTCAATGGCCAGCATCTAGTCAAGAG
          TCATTCGAGCAACGGGGTGGAGAAGTCCCTATTGGCCTGGGCACGTCAGTATACGGAACCTCATGGCCTGCAGCTAAATG
          ATTTCTCCAGTTCGTGGTCCGACGGAAGAGCCTTCCTCATGATCCTGGATGCTCACGTGGAGGAGCTGAATCTGCAGGCG
          GCTTTGCAGCAACATGCACTGAAAAGATTGCATTTGGCTTTCGATTTGGCACATAGGCACTTTAAGATTGAAAAGCTATT
          GGATGCCGAGGATGTGCACACCCACAAGCCAGATAACAAGTCAATACAGATGTATGTGATGTGCCTTTACCACGCCATGG
          AATCCATGAGGACAAGGCAGCAGGAGCAGGAGCAGGATGAGGGACAGGATCAGGATCCAGGGAGAGTGCCCTGCACCAGC
          ATCACAGACTTGGATGAGGTGCCACTGGACAATGATCAAACCAGTTTGGGGCTTTATACTTCAGACAGTGCTGGCAGCAT
          GGAGCAGCGATCTTCGGGGGAGCTAAAGACCCACTCCATGCGTCCGTTGAGTACGGCCACCAATGCGAGTGTGGAGATCA
          GTGGCTATCAGTCAGCTCTCGAGGCAGTACTCACCCTCCTATTGGAAGATGAACAGCTGCTCTCGCAGAATTTGCCGGAT
          CCCCAGGATTTTCAAACTGCCAAGCTGCAGTTTCACGAAAACGAAAGCTTCATGCTGAAGCTGACCGAACATCAGGAGTA
          TGTGGGAGAAGCTCTGGAGGAGGGTAGCAACCTCATCAACGAATCCCAGAAGGCAGGAGCTGGTTTGAGTCAGGAGGATC
          AAAACGAAGTGAGGCAACAAATGGTGTTGCTCAACGAACGTTGGGAAACCTTGAGATTGCGAGCTTTAGATGTTCAAGCC
          AAAATTCTAATGAGATTGGCCGAGTTTCAGAAGCAAAAACTCGAACAGCTTCGTCAGTTTTTGACCAGTGTCGAAGATCG
          TATATCCCATATGAGTGATATAGGACCAACCCTAGAAGAAGCGGAAAAACAACTTTTGGAAGCTCAAAAACTCAAAGCAG
          ATCTAAGTGAACAGCAGGAATTGGTGGATAGTCTGAGCAGCATGGTCGTCATTGTAAACGATACCTCTGGCAACTTTAAT
          GATCTAGAAGATCGCTTGAGTGCCTTGGGGGAGAGATGGTCGCATGTGGTGAAGTGGAGTGATTTGCGAAAAGAGAAACT
          GCAGCAATATAAATGTATATCCAGATGGCTGGATGCACGCGAGCAGGATCTGAAGCTCATGGAGAGTCGGGATGTCACAG
          ATGTGGGCGGCATTACACAGCGCATCAATGAGCTAAACTATTGTGCCAAGGATCTGTTGGAACTGCAGAGATATCTGATA
          GATTTGCGACAAATGGTGGCTGCCACTTTACAGGATGGTGATGACAAGGGCGAAAGGGTGCTCATCCAATTAGAGAGTTA
          CGAAGATCGTTTAGATGCCTTGAAGCAGATTGTTGAAGTGCAAACTGTGCGAATCGAAACGAAGGGCTTTAACTTTGGAC
          GAGATCGTGCTAGCTATGATGACAGCAGGGTAGTGCGTCCAGAAGGATGGGTGGACTACCAGATGATCATACGTTTCGGT
          GAAGATGATTCTCAAGAAGACGATGACGAGCATGACTTGGCCAGCAAGAAGCGAAAGCTTAGAAACGCTGACAATTTCAA
          TGCCCTCGAGAATCACATCATGGAGCACTTCGGCTATGTCCAGGAAGTGGAGCAAAAGCTACAGCAGTTGCAGAGGCAAA
          GTCTTCGGCAACAGTGTGAATTACTCAAGGAACTTCAGGCGGAAAATAGTCGACGCTGCGGTACTTTACCCGAACTTAAG
          AAACTCTACGAAGTCTGTGAGCTGGAGGATCCGTCGAGGAACCTTCTCCTGGAGGAAACACACATCAAGCAGCTGGAGCA
          ACGATATGCGAACTTGTCTCAAAAACTATCGAGCCAACAGAGCGAAAGCCATACGCTGTTGGCCAAAGAAAAGTATTACA
          ATAGTCTGACAGGATTTAAATTAGTTTTAGCTGATTCCAGAGATTGGTATAAACAACACGCTGGCTCAGCCAGTGGCAAC
          GAGCTAGAACAGCGTTTGAGCCACATGGAATCCCTGGCATCGGAGATTTCCGAGGCCAAGACAGCCACCGAAGAGCTGGA
          TGATAATCTAATAGAATGGAAGCAGGACTTTGGTCTGTTCTACGACAGTTGGCATGACATGAAGCAGGCTCTGCAGGCTC
          TAATTCAACAGAGAGGCGGCGAAAGTCTTTCCAGACAGTTGAAACAAATCCAAGATTTTGTTACCAAAGTGTCCAATCAA
          AAGGTTCGCGTTTCCAATCTGGAAGTCATGCAGGAGCAGCAGCATTTTCTAAACCAATTGTTAGACGAAATGGAGTCCCT
          TCGGCTAACTTATGATAATATACCAAAACACCTGATTGGCGAAGAACTACAAACCGCTTGGAACCGACTTCCCGAACAGC
          TAAATGAGCGCGTGATTAAACAAACCACAGCTATAGAAAACCTAAACCACTTTGCTGCGGAGTATAATGCCATTATAGCC
          ATGCTGCGAAGTGCAGCCGATTCCAAGTTGAACGGAAGTGATGGTGCTAGCAGTCAAGATCTTCGAAAACTGGAGATCGA
          TGTGATAAGCGCTCGAAATTTCAGCGAAATTCTGATCAAGGAGGCGGAGCCAGCCCAAAAGGAATCGCTACAATCACAGA
          TAAGGGCTCTCAATACGTTGTACGATCAAGTGGAACAGGTTCATCGGGAGAAGAAGGAACAGCAGACGGTTCTGCAATCC
          CATATTGATCTTATCCAGCTAAGGCTCAAGGAAACCGATCAGTGGTTAACTGATCTGGAGAGTAATACACCCAAATCGGG
          AATCAGCGATATAGTAAACTCCAACGAGTTGTTCCAGAGCAAGAGTCGCTTTCAGACTCTTAAAGAAACCTGCGAAAGGG
          AAACCACACAGTTTAGGGATCTCAACGAACGTGGTGGTGAGCTGCTGCTCCAAATGGATGAGCTTCAGGACCAGGATAGG
          GAGTCCCGATACGGATCGCTAGCAAAGCAATTCACACGCATCAATGCCAGATGGACGGAGGTCACCGAGCTGGTTTATGC
          GAAGACAGCTCTTCTCGAGCATATATCAACGCAGCTGGGGGAGTTCAAGAAGTTCATGGTTAGCGAGACGGGTTACCTGG
          ACAAGTTGGAAAACAAGATACGCAACACACCAGAGAATGCAGCCGACGCAGAGGAGATCATGGAGGAGCTTGATGATCTG
          GAGAACGTTCTGCGCTCGCACTCTGAGGAATGGCTGGACAAGATTCAGGAAATTGGCAACGAGCTAATTGACAACGAATT
          CATGGCCGACTCCATACGACGCGACATTGATGAAACCGTTCAACGGTGGACGCAACTCCAGCAGCAGGCAAAGAAGCGAA
          CCGAGCTCCTGGAGCAAAAGGTCAGCGAGGCGGAACAGTCCGAGAAGTGCATCGTGCAGTTCGAGAAGTGGCTGACACGT
          GTGGACGACATACTCAGCGATCATCTGGATAACGATGTGACCATTGTAGATCAGCCGGAGGAATTCCAGCGCTTGGCACA
          CGAGTTTGTGGCCAATGAGAAAAACTTTAAGGAGATCAGCGAACTTATTGACGAGCACACGAGGAACGGCAAAGTGGGAG
          CTGCCAATCGGCTACAGGAGCAGCTTAACCTGATGGAGGTGCGGTTCAAGTACTGTCAGGCAAAGCTGAGCAAGTGCACC
          GCAATCCAACATTCCTACGAATCGCGTTTGAATAGGGCCTATACGGATCTTCGAAATGTGGAGCGATCCACTGAGGTAGT
          AGATGTCGCATCCGCCGGACCCAACACGGTTCAGACTCAATACCAAAAGTGTCTGCAAATTTATCGCACTCTATCGGAGA
          TAAAGTCGGAAATAGAGAGCACGATTAAAACCGGTCGCAGGGTTTGCGAGGACAGGTACACAAAATCGCCGAAGCAACTT
          AGTCAGCGGATTGATGCGTTGAAGCATCTGTACAATACCCTCGGAGAGAATGTGACCCAGTCAAAGGCGACCCTGGAAAG
          GCTGCTCACATTAGCGAGGCAATTAGAGGAGTGTTTCGATTCGGCAGACAACCTAATCCGGCGCTTTGAGTCGCCGCAAG
          AGGTCCATGACAGGAACTCCATACTCCTGGAGTTTGAGGATGTGCTGCGAAGGTGCGAGGACCACTACAATGAGTATAAC
          AAATCCTGTGACCAGAGCTGCATGGTGGAAACCCGTCAAAGGATCGATGGATTGAAGGCTACGTACCACAAGTTGACCAG
          TGCGGACATAATCAAGCGGCTCACCGAGATGAAGACCACCCTGCAGAACCTGGACAACATTTCATTGGAGACTTTAAGGG
          CAATGGAGCACGACCTGAAGGAGATAAATGTGCCCTCGAATCCGGAAATTGAGAAATTGCAGCAGCAAGTAATTGCAATT
          GTCGTGGATGTGCTGAAAACCCGTTTCAATGAAGCCACAACGCTTGCCGCTCGAAATACGAGCTCTCCCGACAATGACGA
          CACGGAAATAGTTGTGGTCAGCGATACAGTGCGTCAACGACGTGCCAGGACACCCCAATCGGGGGAATCGCCGTCATCCG
          CCCACACCAGTTCCTCGGAGTCGCCAACGAAGGGTGTGGAGAATAGTCCGGGAGCGGTTGGCGACCAAGTCATGCCGGAT
          CTCCTTCCACCACAAACATTCCGGCTGGCCGAGTCCAGTACTCTGTTCTCGCAGATTTCCCTTAATCCCCAAAAAGTAAC
          CAACACTCCACCACCCAAACCGGCGAAAACTAAGCGAAAGGCCCCAAGTTCTCCCGCCCAAGTTGTGGAGATCAGGGTGA
          AGAACATCCAAAACGATAAAATGTCTGTGCAGAATATCGATCTGGAACCACAGCAGGGTGAAATCGTAGACACCGTCAAT
          ATCCTGGAGAGTGTGGAACCATTTGTACCCGAATATGTGGAGACCGTACAGATTGTAGATCTCTCCGAGGACTCAGATTC
          ATCGGTCAGAGTTGATAGTCAGGGCAAGGAGATGCGACGATCGAAGAGCAAGCATTCTTTGAACGAGACTCCACTGCCCA
          AGGTTTCGGATAACGATGAAGACTCGGCGGAACAGGAGGAGGACCTCCTGCGTCCCTCGGCAGAAAATACAAGCACTCCG
          TTCCTGAGGGTGGAAAAACGCCGCATTTCCTTCGATGAGAAACGCAAGCGAGTAGCTAATGAGCGCGATATCCTGCGCGA
          TTCCGAAGAGGAGGAACCCAAAACACCGGATACTCCACGGGCAGCGCAAGTCTCCAAGCCAAAACGCTGGCGCCAACTCC
          AGCCAGAAATGGATGCTCTGGAACCCGAATCACCCGGTCGCGATAGTTTCTATAGTCCCGACAAAGAATCCGGTTTCGAT
          GCTGAGCCTCTCGTATTTTCCGACGATGAGGATATACCGCGTTTCTCGCTGGAAATGACATCAACCATTGACTCCGATAG
          TGATACGAGTCGCATTATGACGCCTTCTACCAAAAATCCCAATCCTTTCCTGAGCAAGGTCCTGGAATCATTGTCTTCTC
          CGGTGGATGACTCAAATGTAACGCTCAAAAGCCCGATCAGCGAAGAGCAGCCCCAGAATCTGGATGATCGTGTCCGAGAG
          TTCGACAAGCAGGCCAAGCAGATGATCTACAAGTTGAAGCTTACGAAGGCCAAGATTGAACAGTGTCACGAAAGCGAAGC
          AGAGGACCTGCGGCTCCTAATAGCACCTGATGCAGCCACCTTGATATCCCAAGGCGACTCATTGGTTCTGGAAACTCATG
          GAAGACAGGGCAGCATATCCCGCCTGGTGATGCGCACACAAATAATATTGAGGGAACAATTCCGAGAAGTGCAGCAAGCA
          AGATCCAAGACCTCGGGAAGCGGGGCACCAGCTCCTCCACTGGACAGCGTAAACATCGAGGAGCTGGTCACCAAAGGACT
          GCGTCGCATCAACGTTCTCATAGAAAAGACCGTCGATCTAAAGTCTAGCACTGATCTTGAGAAGCGCATGGAGGATATCA
          ACGAGCGGCACGACGATTTGCAGGTGATTGTCAGCGCCATTGGCAAGAACGCCCAGATGCCGAAGGTCACGCCCCTCATG
          ATGAACGAAATTGAAAAGACGAAAAACAATTTGATAGCTCATGCGGATTCCATTGAGCTCTCGTTGACGGAACTTAGAAA
          TGGCCCCCGAATTTCCAATGGTAAGGAGCGCCCAGATGCATCCAGTGCGGCCACCATGAGCTGTCGTTCCGAGTACAATA
          ACGAGCCGAGTGGTACTGGAGCGTTGGCCGGCAGCTTCGATAAGTCGGTGCTGCAAATTTCCGACTGGCTGACTTGGGAA
          CAAAACATGATCAAGATACAGAGCGTGCTCGTCGACGATGGCGATGCAGTGCGACTGGCCATCGAGAAGCAGGAGAAAGT
          CCTGCGTGAATTGAAAATGAAAAAGCCGCAGCTCAACGAACTGGTTCACACAGCGGAAGTGCTCAAAGGCGACGTAAAAC
          GGCAACAACTGCAGGAAAAAGAGCTGAAACAGTTTTCCCTAGCACCGCACTGTTCAGCGGACTTAGATTATATGCGTTGC
          TGTCTGAAAGTGACCCGATTGCGAGAGCACTGGGATGAGACGTCCCAATGTGTCCTGCAGCGAGCTGCCCAACTGAAAAA
          CATGCTGAGCGACTCACAGCGGTTCGAGGCCAAGCGCCTGGAGCTCGAGAAGTGGCTGGCCCGCATGGAGCAGCGGGCTG
          AGCGGATGGGAACCATCGCCACCACAGCCGACATCCTGGAGGCACAGCAAAAGGAGCAGAAGTCCTTCCATGCGGAGTTG
          CACCAGAACAAGCAACACTTCGATATCTTCAACGAGCTGACACAGAAACTGATTGCCGTCTATCCCAATGATGATACCAC
          CAGGATCAAGAAGATGACGGAGGTCATCAATCAACGATATGCTAACCTAAACAGCGGAGTCATCAATCGTGGCAAGCAAC
          TCCATGCAGCGGTGCACAGCCTTCAATCTTTTGATCGAGCCATGGATCAGTTCCTTGCTTTTCTTTCGGAAACGGAAACA
          CTTTGTGAAAACGCCGAGTCTGATATTGAACGCAATCCATTAATGTTCAAGGACCTACAATCGGAAATTGAAACCCATCG
          CGTGGTTTACGATCGTCTCGATGGAACAGGCCGCAAACTTTTGGGTTCGCTCACCTCACAAGAGGATGCGGTTATGCTGC
          AGCGTCGCCTCGATGAAATGAATCAACGTTGGAATAATTTAAAATCGAAAAGTATTGCAATCAGGAATCGCCTGGAGTCC
          AATTCGGAGCACTGGAACGCCCTGCTCTTGTCGCTCCGCGAACTGACCGAGTGGGTTATCCGCAAGGACACCGAACTGAG
          CACTTTGGGCTTGGGTCCCGTTCGAGGCGATGCCGTCAGTCTACAGAAACAGTTGGACGATCATAAAGCCTTTCGCCGCC
          AATTGGAGGATAAGCGGCCAATTGTCGAGAGCAATTTAACGAGCGGTCGTCAGTACATCGCCAACGAAGCAGCCGTCTCG
          GATACCAGCGATACGGAGGCCAACCATGATTCCGACTCGCGTTACATGTCCGCCGAGGAGCAGAGCCGTGAGCTAACACG
          CAGCATCCGGCGGGAGGTTGGAAAACTTTCCGAGCAGTGGAACAATCTAATCGATAGATCTGACAATTGGAAGCATCGCC
          TGGATGAGTACATGACGAAAATGCGTCAGTTCCAGAAGATCCTGGAGGATCTTAGCTCCCGCGTTGCCCTTGCCGAGCAG
          ACAAAAACCTCCTGGCTGCCACCCTCATCCGTGGGCGAGGCCAATGAGCAGATGCAACAGTTGCAGCGCCTGAGGGACAA
          GATGACGACGGCCAGTGCATTGCTGGATGATTGCAACGAGCAGCAGTCCTTCTTCACCGCCAATCAGGTCCTGGTACCCA
          CACCCTGCCTCTCCAAGCTGGAGGACTTAAACACGCGCATGAAACTCCTGCAAATCGCGATGGACGAGCGCCAGAAGGTC
          CTTTGTCAGGCTGGAGCCCAGCAGACGCACGAGAACGGCGACGACGGACGCACCACATCGAACAGCGGCACCATTGGACC
          ACTGCCCAATCTCGGCCAGAGCGTGAAGCCGCCATGGGAGCGGGCCACCACAGCCGCCAATGTGCCTTACTATATCGACC
          ACGAACGCGAGACCACGCACTGGGACCATCCGGAGATGATTGAGCTGATGAAGGGCCTGGCAGATCTCAACGAGATACGC
          TTTTCCGCCTACAGAACGGCCATGAAACTGCGATCAGTTCAGAAGCGATTGGCTCTCGACAGGATTAGCATGTCCACCGC
          CTGCGAGTCCTTCGATCGACATGGCCTGCGTGCCCAAAACGACAAGCTGATCGACATACCCGACATGACCACGGTGCTGC
          ATTCGCTCTACGTGACAATCGATAAAATTGATTTGACGCTAATGCTGGACCTGGCCATTAACTGGATCCTGAATGTCTAC
          GACTCACAGAGGACCGGCCAAATCCGTGTCCTCAGCTTCAAGGTCGGACTGGTCCTCCTCTGCAAGGGTCACCTGGAGGA
          GAAGTATCGCTATCTGTTCCGCCTGGTTGCAGACACTGACCGACGAGCGGATCAGAGGCGACTGGGACTCCTGCTGCACG
          ATTGCATTCAGGTACCCCGCCAACTAGGTGAAGTAGCCGCTTTTGGTGGCTCCAACATAGAGCCCTCGGTGAGATCCTGT
          CTGGAGCAGGCTGGCATCTCGCAGGAGGCCATCGATGGCAACCAGGACATCTCCATCGAGCTGCAGCACTTCCTCGGCTG
          GCTGCAGCATGAACCGCAGAGCCTCGTGTGGCTTCCGGTGCTCCATCGCCTGGCGGCGGCGGAGGCGGCCAAGCACCAGG
          CCAAATGCAACATCTGCAAGGAGTACCCGATCGTCGGCTTCCGCTACAGATGCCTCAAGTGCTTCAACTTCGACATGTGC
          CAAAAGTGTTTCTTCTTCGGCCGCAACGCCAAGAACCACAAGCTAACTCATCCCATGCACGAGTACTGCACCACTACCAC
          ATCCACCGAGGACGTTCGTGACTTTACACGCGCCCTGAAGAACAAATTCAAGAGTCGCAAATACTTTAAAAAGCATCCAA
          GAGTGGGATACCTGCCCGTTCAGAGTGTTTTGGAAGGTGATGCTCTGGAGAGTCCGGCGCCAAGTCCGCAGCACACAACC
          CACCAGCTGCAGAACGACATGCACTCCCGCCTGGAGATGTACGCCTCGCGACTGGCTCAGGTGGAGTACGGCGGAACGGG
          CTCGAATTCCACGCCGGACAGTGATGATGAGCACCAACTGATCGCTCAGTATTGCCAGGCTCTGCCCGGAACTTCAAATG
          GAAGTGCACCCAAGTCGCCTGTCCAAGTAATGGCCGCCATGGATGCCGAGCAGCGGGAAGAACTAGAGGCGATCATCCGC
          GATCTTGAGGAGGAAAACGCCAACCTGCAGGCAGAGTACCAGCAATTGTGCAGCAAGGAGCAGAGCGGCATGCCCGAGGA
          CTCCAATGGCATGCAACACTCCAGTTCCAGCATGACGGGTCTTTCTGGCCAGGGCGAGCAAGGCCAGGACATGATGGCGG
          AAGCGAAGCTGCTGCGCCAGCACAAGGGACGCCTTGAGGCGCGCATGCAAATCCTGGAGGATCACAATCGGCAACTGGAA
          GCTCAGTTGCAGCGACTACGCCAACTTCTCGATGAACCCAATGGCGGCGGCAGTAGCGCCACCAGCAGCGGTCTACCCAG
          CGCTCCCGGTTCCGCATTGAACTCCAAACCCAATACCCTCCAGACCCGGTCGGTGACCGCCTCGCAATTGAACACGGACT
          CACCGGCAAAGATGAACCAACAGAACGGCCACTACGAGCACAACTCAAAGAACTCAAGTGGCCTAGTGACCGTAATCACA
          GAGCAGGAATTGGAGAGCATCAACGATGATCTGGAGGACTCGTCGAGCAGCAACACTACGAACACCACGACGACGACGAC
          GACCACGGCAACCACGGAGAAAACTTGCGTGGAGCTGCAAAAATAACACCTTCGATACTTAATTGCATGGCATTCAACTA
          TGAAACAAAACAATGAAACAGTATATGAATCCAAAAGAATTAAATGCATGTGAGGAAATCCAATTGGCTGGCCTGCAAAA
          CATTCTAAATAATCATACCTAAACACCTAAAGATAGATCCATATAACTATTGTGGTACATATATTTATACACTATTGCGA
          AGAATCAGATGGAAAAGAATTTCAAGAAGAGCTTCGAGTAAGCTGAGAACACTTTTTAGTAGTTATGAAAGATACAAATC
          TATATATATTATATACAAATATCGAAGCATAAGTGAGACATATTGAAAGCTGGAAATAATGCAGAAATGATTTAAAGATT
          AGATAAGCTGTAACTCCAACACATACTTACATCCAATGATATAATAAAAAAGAAACAACTATATCATAAATGAAACATAT
          TCATAATTTCCTAGTACATGAAAAATTGTTATAACTCGCACCTTTTTCAAACAACTGATAGGAAGCAAATCAATTTCAAA
          GATACAAGAAGAACCAGCTAACAGTTTTTGGTTAGCTTTCATATCATTTTAAAGCTTATACAATAAGTGTTTTAAATGTA
          AATTTCGAAACATGCAATCAGTTTTAATTTGTATCCTTATTTATTCCGATTTCTTGTGTATTATTTCTTAATATTATTTA
          ATATTAATATCTGTGCTAACTGAAAGTGTGCTGCAATGTTTTTAATTAAAGAACTATTATT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0083766
          5814
          FBtr0083765
          10593
          FBtr0110915
          6597
          FBtr0110916
          4821
          FBtr0110917
          13484
          FBtr0110918
          11374
          FBtr0110919
          11964
          FBtr0334562
          12758
          FBtr0334563
          4723
          FBtr0334564
          10644
          FBtr0334565
          5187
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0083178
          3497
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0083180
          1669
          FBpp0083179
          3127
          FBpp0110215
          1854
          FBpp0110216
          1051
          FBpp0110217
          3529
          FBpp0110218
          3504
          FBpp0110219
          3598
          FBpp0306629
          3228
          FBpp0306630
          1152
          FBpp0306631
          3144
          FBpp0306632
          1323
          Comments
          Transcript terminates at site supported by polyadenylated cDNA.
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (3)
          Reported As
          Symbol Synonym
          CG31175-RA
          det-RA
          Secondary FlyBase IDs
            References (2)