General Information
Symbol
Dmel\fru-RF
Species
D. melanogaster
Annotation Symbol
CG14307-RF
FlyBase ID
FBtr0083644
Feature type
Associated gene
Evidence Rank
Length (nt)
6960
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 8 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CAGCAAGGACGCACAGCTCACACAATCCCTTCGAAGGAAATCAGCAGCCGACATACCGAACGACCTGCCACAACATTCCA
          ATTCAAATCCAATCCAATCCAGACTTTGAAGTCCTGTAAAGCGTTTTACATTCCGCTTACATAAATGCTAGAGCGCTGTA
          AAAATCGGCGCTAGAAACGCCAATTAGCCAAACATGTTAGCCATGTTTTAGTCGGTCCTTTCGCGCTTGACTTGTTTTGC
          AACTGTGTGCGTACGTTTGAGTGTGCGAGTGCCGCCCGATTTTGTTTGTCCTTTTTTTTTCTGTTGGTGTCTCACCGAGT
          GCCGTTTTAAGCCAAGATACTACAGACATACTAGCGACTAGCTAATACATATTAACTTGTTGTGCCAGCGTTTTGTGTGT
          GCCAGTCAGCCTCTGCTGAGTGCATTTTCATTAAAGTCAACAAGTTGCAGCCGCATAAGGTCAAATAAAAGCAGCCAGAG
          CCAAAATGATGGCGACGTCACAGGATTATTTTGGCAATCCATACGCCCTTTTCCGTGGACCGCCCACAACTCTGCGGCCG
          CGCGAGTCGCCGCTGGGCGTGGGCCACCCTCACGGTCATGGGCACCTGCACAGCCACGCCCATGCCCACGGGCACGGCCA
          CGCCCACTCGCATTACGCGGCCTTGGACTTGCAGACGCCGCACAAGCGGAACATCGAAACGGATGTGCGGGCACCGCCGC
          CGCCATTGCCGCCGCCACCGCTTCCGCTTCCGCCCGCATCCCCTAGGTAAGCCTCCCCACCCCCCCCCCCCCCCCCGAAA
          AAGAGTAAAACCAAAATGGGGGAGGAAGAGAGAAAGTGGGCAGTTTAACACCAGATCGAAGACGAGCAAAGAATTGCGGA
          GAAATCAAAAAACCAAAAGCCAATTCACATTGGCATATCATCAGCAACACACATCAACACACTTCTCTGCTATGTCTGCA
          ATCAACCAAAATATCGAAAAAAGAAAAACAAAAAGAGTCAACATCAATTTTAAAGTTTTTACGTTGGTTCAAAAGAGTTT
          AAAATGCCCTTAACTATTAACGCCCAAAAGTAAACGTAGATTAAAGTAATATTAGCCAATCAATCGTAAAATATCAGCTT
          TCATTTTTTAAACCTTACCAATGGACTTTGATCCCATCAATTGCAAATCTAAAGTAGAGAAATAGAGAGAGATAAGAGAT
          ATAATATCACTAACCAAAAGTGTTTGCCACGAGTATTAAAATGTTAACTACTACAATAGAATACGTATTATGTTTAATTC
          GCTAGTATGTATAAGCAAACTAACTGCAAGAAACAACACCAACTAATTAATATTCAATAGCATAATGCTAATATCGTAAG
          AATATCATAGATTTAAGGCAGAGCATTTCAGACAGCACTTGTACCGTTCTAGACTTAAGAATTCGAAGTATACGTAACTC
          AAGCAATTCAATAACAATAACTAAGTAGAAATTCTTTTCAAAATAATACTATACACGAATACTTCAGTCAAACCCCCTAC
          AATATTACTGAGATAAACATATAGTATTATATAGCCAAAGCCAGGAAAGGAGTTGTAAGCCATTGCATATATATATTTGG
          TAGATAAAGAACAGCTAACGAAAGGGTCCACAAGCTACCCATAACTTACTTAGAATAACTAAACACAACTAGCCAAGAAG
          TAGATATACATATATATATCGAGTTTTGCTAATATCAAAGTATACGTAAATTGAAAACCAAGAATTTTGCCTAGCTTAAA
          TAACACTCTTTCAAAGCAATACCATAAACAATAATTACAAGTTAACGCAACTAAACACATATTGTATACCAGATAGTTTA
          TGCCTAAACACTACTAGTAGCCCTAAGTCCTAGGCATAAACCGAGCACCACGGCGAGATATGCACCCATGTAAAATGCAG
          AAATTAATTACCAAGAGTACAAACTGTAAAGGAAACCCCTATTGAAGCTCAATTGGCCAGCCCATCTAGTGTAGCACTAA
          GTAGTTCGTAATCGTAAGCAATTGTAAGGCAAACACTTTTCAAGTGAGCGAAATATCAAGCAAACTGTGAGAATTCGAGG
          ACGTGTGACGATGGAGCAACCCTTCCCCCCCAGATCGAAAGAGAGAGATATCATCAATCAACATTCCCGTGCCCGGAGGA
          GCTGCTCTTCAATCAACACTCAACCCGAACTGGGCCCTCAAAAGCCCGGCAACCTAAAGTTAGTCCTTTCATTAGCCTCT
          TCTATCAATTAGTTAGTCAGCCAACGTTTCTCTCTCTCATAATTCTAACCGAAAGTAAGCATAGAAAAGAACCAATACTT
          CAATCAACATACCCACAAAAAAAAACAAATTCCCACCAACTGGCGCGGTACAACACTGACCAAGGAGCGATGGACCAGCA
          ATTCTGCTTGCGCTGGAACAATCATCCCACAAATTTGACCGGCGTGCTAACCTCACTGCTGCAGCGGGAGGCGCTATGCG
          ACGTCACGCTCGCCTGCGAGGGCGAAACAGTCAAGGCTCACCAGACCATCCTGTCAGCCTGCAGTCCGTACTTCGAGACG
          ATTTTCCTACAGAACCAGCATCCACATCCCATCATCTACTTGAAAGATGTCAGATACTCAGAGATGCGATCTCTGCTCGA
          CTTCATGTACAAGGGCGAGGTCAACGTGGGCCAGAGTTCGCTGCCCATGTTTCTCAAGACGGCCGAGAGCCTGCAGGTGC
          GTGGTCTCACAGATAACAACAATCTGAACTACCGCTCCGACTGCGACAAGCTGCGCGATTCGGCGGCCAGTTCGCCGACC
          GGACGTGGGCCGAGTAATTACACTGGCGGCCTGGGCGGCGCTGGGGGCGTGGCCGATGCGATGCGCGAATCCCGCGACTC
          CCTGCGCTCCCGCTGCGAACGGGATCTGCGCGACGAGCTGACGCAGCGCAGCAGCAGCAGCATGAGCGAACGCAGCTCGG
          CGGCAGCAGCGGCGGCGGCGGCAGCAGCAGCGGTAGCGGCCGCTGGCGGCAATGTGAATGCGGCTGCCGTCGCCCTGGGC
          CTGACCACGCCCACCGGCGGCGAACGATCTCCGAGCGTGGGCAGCGCCAGTGCAGCGGCGGCAGCTGCAGCGGTAGCGGC
          TGCGGTGGCAGCGGCCGCCAATCGAAGTGCCAGCGCCGATGGATGCAGCGATCGGGGAAGCGAACGCGGTACGCTCGAGC
          GGACGGATAGTCGCGATGATCTATTGCAGCTGGATTATAGCAACAAGGATAACAACAATAGCAACAGCAGTAGTACCGGC
          GGCAACAACAACAACAATAATAATAACAACAACAATAGCAGCAGCAACAATAACAACAGCAGCAGCAATAGGGAGCGCAA
          CAACAGCGGCGAACGTGAGCGGGAGCGAGAAAGAGAGCGTGAGCGGGACAGGGACAGGGAGCTGTCCACCACGCCGGTGG
          AGCAGCTGAGTAGTAGTAAGCGCAGACGTAAGAACTCATCATCCAACTGTGATAACTCGCTGTCCTCGAGCCACCAGGAC
          AGGCACTACCCGCAGGACTCTCAGGCCAACTTCAAGTCGAGTCCCGTGCCCAAAACGGGCGGCAGCACATCGGAATCGGA
          GGACGCCGGCGGTCGCCACGACTCGCCGCTGTCGATGACCACAAGCGTTCATCTGGGCGGCGGTGGTGGCAATGTGGGCG
          CGGCCAGCGCCCTTAGCGGTCTGAGCCAGTCGCTGAGCATCAAGCAGGAGCTGATGGACGCCCAGCAGCAGCAGCAGCAT
          CGGGAACACCACGTGGCCCTGCCCCCAGATTACTTGCCGAGCGCCGCTCTAAAGCTGCACGCGGAGGATATGTCAACGCT
          GCTCACGCAGCATGCTTTGCAAGCAGCAGATGCGCGGGACGAGCACAACGACGCCAAACAACTGCAGCTGGACCAGACGG
          ACAATATCGACGGCAGCAGCGCCCGCCACCACCTGTCGACCCCCCTGTCGACCTCGTCGTCGGCCTCGCCCCCGCCGCCC
          CCTTTCGGGATGCACCTGTCGGCGGCCCTGAAACGCGAGTACCATCCTCTGCACTATATGGCCGCCGGCAACGGTCACAA
          CGGCCCATCGGCGCTTGGTTATGGCAATCAGGGATCGGGCAATGCGCCGAATAGTGCCGGAGGAGCTGGATCGGTTGCGG
          GCGGAGTGGGAGCCGGCGGAGGAGCCGGCGGAGCAACTGGAGCAGCTGGCCATAATTCGCATCACACCATGTCGTACCAC
          AACATGTTCACGCCGTCCCGCGATCCGGGCACCATGTGGCGGTGCCGCTCCTGCGGCAAGGAGGTGACCAATCGCTGGCA
          CCACTTTCACTCCCACACCGCCCAGCGGTCCATGTGTCCCTACTGCCCGGCCACCTACAGCAGGATCGATACGCTGCGCT
          CCCATTTGCGGGTGAAGCATCCGGATCGCCTGCTCAAGCTGAACTCATCCATTTAAGGGCGTGGCCGGGGCCCAAGTGCA
          GCCCATCACCGCCAGCTTTACCAGCAGCAGCAACAGCCGCATCATAAGCAGAAGCAGAAGCAGCAGCAGCAGGAGCAGCA
          ACAGCAGCAGCAGCATCAGCCGCATCAGCAGCAACAGCAACCAGCTTACTACGTCAGCAACTATAGCAACTACAGCAATA
          ATAGATACAGCTACAGCGATAGTTTATTGTAAATCGCTGCAGTTCTAGGTGGATTTTTCTTGCATTTAGTCGTCGTCCAG
          TCGTGTACATTACCCACTAGCTATCCAAGCAATAACCATAACCCAAACTAGTAGAAAACCGAAGATGCTATGCTATGGCA
          AAACGTAAAGCGTTAAACACAAGTATATTGATAATCTTAACTAAACTTATTGATAAACTTTGACACAATCGTCCCATCAA
          TTTATAAATGTGTATAACTAAGGAAGATTAGGAAAAGGTTTCAGTTGCGAGTCGAGGAGAAGGATATGCCCAGCATAGAG
          GGCCAGTGGAGGCGGAAAAAAAGTTTTCCAAAGCCACAACAAACCGTTTCGAAGGTTTCTAAATGTTGTTTCCTAAAAAC
          TATAAAGTAATAACTACACTAATACTAGAGAGAGAAAGTCGAGGAGAATCGTTTTGAGCCGATTCAGCAAATTGGGGTCA
          CTACCACATCACGCGGGGTCACCAGCAGCAGCAGCAGCAGCAGCAAAAGGAGGATGCGGATGCGAATGCGGATGCGGATG
          AGGATCAGGATGAGGATCAGCCAGCACAGCAACAGTCACCCACAAATACTACTCATACGAAGGTCACATTAGGTTTTAGT
          TTACTTTAATTTGTAATGTCTAGATTTTAGTGTTAACCGATATGTTCTGCGGAGTAGGAAACGGATGAGGGCTACTCAAC
          CAACTACAAAGAAATTTTCATATACCTCAAATGCATTTCAGTTTTATTGTTGATTGCTTTAATTTTAGTCTACGTAGTCA
          GTTAGCACTTATACATAAAGTACCACATACATATATGTTATTTTTTAATCGGTTCCAATTTGAATCGGCGAGATAGCCAA
          TAGTTTACCAATGTTTTCCTCTGTTTTTTAGTGTGTGTGGTGTGTTCCCTATCACTATCACACTTTTGATTTTGTCCTAT
          GCGTTAAGTTGAAGATTTTAGGATTAGCTCGAACCACTTGAACCACCTCACTTTTTTTTGTTAAGCTTGTTTATATTTTA
          TATTTATGGTCACACGTTTATTTAGTTAAAGTACACTAAACACATATGAAATCACGCGGAAGAAAGTTAGTTGATATGAG
          GGCTATACAAGAAAAAATCATATCACAAAAATCTAAAAAAAAAAAAAAAAAATAAGGAGAAATAATTGGAAAAATCTATA
          GAAATTATATTTTTAAATTGCTTAATTGTCTGCTCGATTGGCAAGAAATTGGACGGTTTAATTCTAATTTGATTACCATA
          ACCCGCAGAGACGGCAAAAGTAATTAATTTTAAACATTTTGTGATAGACAAAATTATGTTTCGGCGCAAAATAAATTTAG
          AAAATGAACCCCTACAATATAAAATATAAAATTAAATGTGATATTTTCGGCACAAAACTTTACAAAAACAAAGTAAATAA
          AAAGTAACATAAGGGAGTGGCAACATTTGGCTAAGATTGCTGCCTTTTTCGTATTTCTTTAGATGATTTTTGTTATAGAA
          CTATTCAAAATTGTTATCTTTCGGTCCAAAGCACAAAATGTATAAAATTACTTTCTAGTTATTCTTTAAACCCTATTTTA
          CTTAACTTTAAAATCTTATTTGATTTCCTAATTATAAATTACGTGCATGTGCGTGTGTATATATATATATATATATATAT
          ATATATCGATTCGAAAATATATGTACACACAGATTTCATAATTTTATTTAGTTATAAGTTGATTGAGTTGAGAAACTTTA
          AGCCAATAAACTACCGCAAAATTAAAAAACAAGAAACAAAAAATAGCACAGATGTTAAGGCAAACCACTACTACACACAG
          ATTTATGTACCAAAAATGTAATAAATATGAAATTATAAACAAAAAACAAAAACAAACGAAACCAAGCAGTCAGAAACCAA
          AAGCAAACAACTAGAGAAAGCTAAAAAAGAAGGAGTCTAGCTGGATTTTTCTAACCTTTTTCCAAACATAAGCATAAATC
          ATAAAACGAAATATTTTTATACATCCACTTGTAATCGGCCGATTGAAAGGAGAGCCACCAAAGATCGGGGGATATAGGGT
          TGCTCTGTCGAATCGGGTCTGGAATATACTATATACTATATTTACCAGATGGCAAACGATCCGCAATCGTCATGCGCAAA
          TACAAAAAAAAAAACAAACAACAGCGAGTTGTAATTTATTTTCCTCTACAGTTACAAACTCAATTAATCAATATGCAAAT
          ACAAATGTTGCAGTGGCCAAATCACACGGCACACCGGCAGCAATGAAAAATATTATTAACAGTTTTCGTCGTCTACCAGT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0083646
          5546
          FBtr0083641
          4159
          FBtr0083642
          5140
          FBtr0083647
          2254
          FBtr0083643
          3539
          FBtr0083645
          6798
          FBtr0083640
          8399
          FBtr0083648
          2842
          FBtr0083649
          2994
          FBtr0083650
          6650
          FBtr0083651
          3402
          FBtr0083652
          2845
          FBtr0301284
          3554
          FBtr0330040
          8399
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0083064
          688
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0083066
          516
          FBpp0083061
          789
          FBpp0083062
          854
          FBpp0083067
          665
          FBpp0083063
          955
          FBpp0083065
          796
          FBpp0083060
          695
          FBpp0089355
          870
          FBpp0089356
          906
          FBpp0089357
          705
          FBpp0089358
          854
          FBpp0089359
          854
          FBpp0290499
          960
          FBpp0303073
          882
          Comments
          Extended 3' UTR based on RNA-Seq and/or EST data.
          C-terminal variant encoded by this transcript corresponds to type B, as described in FBrf0130128.
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (3)
          Reported As
          Symbol Synonym
          CG14307-RF
          TypeB
          Secondary FlyBase IDs
            References (2)