General Information
Symbol
Dmel\His4r-RB
Species
D. melanogaster
Annotation Symbol
CG3379-RB
FlyBase ID
FBtr0082963
Feature type
Associated gene
Evidence Rank
Length (nt)
645
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 86 )
Sequence
ACAAGCAATTTTCTGGAGATTTCTTGAAGTGAGTTTTGTTGCTGAGAAATTTAAGTAAATAATAGAAGAATCGGTCAACA
AAGTTTTTTTGTGCATAAACATAAAAAAAATAATTGGAGACCATTATTTTCCAACTTTACGAAGCAACTGAGAAATGACT
GGTCGTGGAAAGGGAGGCAAAGGATTGGGAAAGGGGGGCGCCAAGCGTCATCGTAAGGTGCTTCGTGATAACATCCAGGG
TATCACCAAGCCTGCTATTCGCCGTTTGGCTCGTCGCGGCGGTGTTAAGCGTATCTCTGGCTTGATTTACGAGGAAACTC
GCGGTGTGCTAAAGGTATTCCTTGAGAACGTTATCCGTGACGCTGTCACCTACACCGAGCACGCCAAGCGCAAGACCGTG
ACCGCCATGGACGTGGTCTATGCCCTCAAGCGCCAGGGACGCACCCTTTACGGATTTGGCGGTTAAGCACGCCCTCTAAC
CTCCACATAATAAATAACCATGGAGTTAACTTAACTACATTCAAAATACTTGATCCAATTGAATCTTAATCAGTAGTATT
CAACGCAAACTTAACCGAACGCAAATATTTTATAATTTCACAATATACGGACTAAATAAATCAAAAGATATCACATAGAG
AACTC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0082962
576
FBtr0082964
753
FBtr0334029
553
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0082422
103
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0082421
103
FBpp0082423
103
FBpp0306146
103
Comments
Transcript terminates at site supported by polyadenylated cDNA.
External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG3379-RB
His4r-RB
Secondary FlyBase IDs
    References (2)