General Information
Symbol
Dmel\Droj2-RC
Species
D. melanogaster
Annotation Symbol
CG8863-RC
FlyBase ID
FBtr0082753
Feature type
Associated gene
Evidence Rank
Length (nt)
1810
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 45 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CAGCACCACAAAATAAATTTTTTTTTTTCATTTTTTATAAGAACTGGCATCCAAATCGGTTGAAACTTCAAAAATTTTCG
          TAAACAGCAAACAAAATGGTTAAGGAGACTGGATATTATGATATACTTGGCGTGAAGCCTAATGCCACGCCCGACGAGCT
          GAAGAAGGCTTACCGCAAGCTGGCCCTCAAGTACCATCCGGACAAGAACCCCAACGAGGGCGAGAAATTCAAGGCCATTT
          CGCAGGCTTACGAAGTGCTGTCCGATGCGGACAAGCGACAGGTGTACGACGAAGGCGGCGAGGCGGCCATCAAGAAGGGC
          GGCGCAGATTCCGGTGACTTCCGCAATCCTATGGACTTCTTTGAGAAGTTCTTTGGCGCTGGATTCGGAGGTAGTGGCGG
          TGGACGCAGGCGCGAGAGGCGTGGCAAGGACGTGGTGCACCAGATGTCCGTACAGCTGGAGGAGCTGTACAATGGAGCGA
          CCCGCAAGCTGCAGCTCCAGAAGAATGTGATCTGCGACAAGTGCGAGGGTCGCGGCGGCAAGAAGGGCAGCATTGAGAAG
          TGCTTGCAGTGCCGTGGTAACGGTGTGGAGACACGGGTTCAGCAGATCGCCCCCGGCATCATGCAGCACATCGAGCAGGT
          GTGCCGCAAGTGTTCGGGAACTGGCGAGACCATTCAGGAGAAGGACCGCTGCAAGAACTGCAGTGGCCGCAAAACGGTGC
          GGGAACGCAAGGTATTGGAAGTGCACATTGAGAAGGGAATGCGGGATGGCCAGAAGATCGTGTTCACGGGAGAGGGCGAT
          CATGAGCCGGAATCTCAGCCGGGCGATATTATTATTCTTTTGGACGAGAAGGAGCACTCCACATTCGCGCACGCCGGACA
          GGATTTAATGATGAAGATGCCGTTGCAACTTGTCGAAGCGCTCTGCGGATTCCAGCGAATCGTTAAAACGCTCGATGATC
          GCGATCTGATTGTGTCCACACAGCCCGGCGAGGTTATCAGGCATGAGATGACCAAGTGTATTGCCGAGGAGGGTATGCCC
          ATTTTCAAGAACCCCATGGAGAAGGGCACGTTGATCATCCAGTTCGAGGTGATCTTCCCGGAGGTGATCAATCCGTCGGT
          GGTGCCCACGCTTAAACAGTGCCTACCCCCGGCGCCGGAGGTTGACATTCCAATCGATGCAGAGCAGACGGTTTTGGAGG
          ACTTTGATCCCAAGCAACGTCGCCAGCAACACCAGCGCATGGCCTACGATGAGGACGATGGCGGCTATCAGGATGGCCCA
          CGCGTCCAGCAGTGCACATCGAGTTAAGCGCCCCCGCTGCGTGTTGCATCCCCGGACACACAGCCCTAATAATACCCCAA
          CCAACAAGCCGTAATAATATGTAAACCAGCTCCCGGAACACTGTAATTGCGCTTGCAAGTGCCGAAGAACTCCCAAAAGC
          ACCTTAAAACACCATCCAATTCACACTAGGAGGCCCAACCAATCGAGAGATCTAAAGTTATTTCATGCAAGCTACGATAT
          TTAGGTATAAATCAAAGAAACTTATCAGATATATGCACTATGTCTATAACGCGTGGTTGTTTGTAAACCAACATTTTTCT
          TTATGTTTATGTTGCGTTGGATTGTCAAAGAATCGAAAACGGAAACTGAAACTAAACTAAACTGAAATTGAAATTAGCCG
          CCACTAGAACCGTATCTAAAGTCCGCGCCAGCGAACACGTCTAGGAACAAGTTTAAGTTATTTAATTCCAGCATAAATAA
          AAGCGTTAGTTTAAACGGATATAACAAATAAATAATTAATACACAATTTC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0082751
          1883
          FBtr0082752
          2021
          FBtr0082754
          1860
          FBtr0082755
          1824
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0082221
          403
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0082219
          403
          FBpp0082220
          403
          FBpp0082222
          403
          FBpp0082223
          403
          Comments
          Transcript terminates at site supported by polyadenylated cDNA.
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          CG8863-RC
          Droj2-RC
          Secondary FlyBase IDs
            References (2)