General Information
Symbol
Dmel\CG1943-RA
Species
D. melanogaster
Annotation Symbol
CG1943-RA
FlyBase ID
FBtr0081635
Feature type
Associated gene
Evidence Rank
Length (nt)
1017
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 130 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      ACACCATATTTGAAATCAACGTTCGTTGGCAAGTGCGCGTCGTTTCCGCATCTCTTATTCGCAAAGTTAAAGCCAGACTT
      CTTCGAGTAGAGCCGTATTCCGGAGTCCTTCCAAGTCACTGAAACCACAACCAGCAGCGACAAAATGACATCCACCGAGC
      TGAAAATCGGCCTGACCACCAGTGCCCGTCCCTCCAGCCGAGTGCTGAAGCCCCCAGGCGGCGGACACACCAATATCTTC
      TCGGAGCCCGACGTGGCCGTTCCCGCCCCGCGTGCCAAGTACAACCAACAGAACTCCTCAAACCTCAATGCCTGCATGGG
      CTCCACGGATCCCAACAAGGTGGTGGAGAAAATTCGCGAAGAGGTCTCCATCCAGAAGGAGGAGGCCAAGTCCGCCCCAC
      CCAGCCAGCCCAAGGAGCCGGCGAACAAACCAGCGGCCACAAATGGAGAGGCACGCGGCCGAGTTCCACCCGGCGGATTC
      TCGTCGGGCGGATTCTGGTAGAGGGAGGAAGGAGGGAAGGAAGTGTGCCCGGGAGCAGAAGCAGCTGCCAAGCATTTAAT
      GACTCACCATCACATCCTCAGACCGACATAAGAATCATAAAACTATAAATATACATAACTCGCTTATAACATACGTATAC
      ACCTATATTTAGAGGCGCATTACCTATATTAACCTGCTGATCAGCCGAAGAAGAAGGGAAACTGATTATATTTTGCCAAG
      CAGCACTCCAAGTCGTTCTTCCTTTCGCCCTTTCATTTTCATGTCCCACATTTGTTCTATTGTCTAAGTAACAGGTTTAA
      AATGTCTAACGAAATTGTTGAAATTAAGTAACTCGTGATTCCGCCCCACAAATACGGATGATATGGATTGACTTTGCTAA
      AATCTACCACCTACTAAGCCTAATTTAGCATTTGTACTTAAAGTGTCCAATCGAATCTTCTTATAGTCTGTAAAATTCGT
      CCAAACGAATACCAATATAACCATCGATGTATTACTCCAAATAAAACATTTAATTGT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0081636
      991
      FBtr0081637
      985
      FBtr0334668
      1207
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0081149
      118
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0081150
      118
      FBpp0081151
      118
      FBpp0306729
      118
      Comments
      Transcript terminates at site supported by polyadenylated cDNA.
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      CG1943-RA
      Secondary FlyBase IDs
        References (2)