General Information
Symbol
Dmel\Cds-RA
Species
D. melanogaster
Annotation Symbol
CG7962-RA
FlyBase ID
FBtr0076688
Feature type
Associated gene
Evidence Rank
Length (nt)
2391
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 89 )
Sequence
CCACTTTGCGCAAGCTGGGCACACTGCATGCTGGGCTAATCAGAAATAGAGAAAAGCATTTTAATTCGGACGAAGTCGAC
ATACGGATCACGCAGCACGGGTCACGGCAAACGGCAAACGCGGAGAGCGGAACACGGACGAGAACTGCTCAAGCGGAATC
AATAGGAATCAATACATTGTGAATAGATCTGGCGAACATCGAATAATGGCCGAAGTGCGACGCAGGAAGGGCGAGGATGA
GCCACTGGAGGACACGGCCATCTCCGGATCTGACGCAGCCAATAAGCGCAACTCCGCCGCCGACTCCTCGGACCATGTGG
ACTCCGAGGAAGAGAAGATTCCCGAGGAGAAGTTCGTCGACGAACTGGCCAAGAATCTGCCGCAGGGAACCGACAAAACG
CCCGAGATATTGGACTCGGCCCTCAAGGATCTGCCGGATAGATGGAAGAACTGGGTGATTCGCGGCATCTTCACATGGAT
TATGATCTGCGGCTTCGCATTGATCATCTATGGTGGACCGCTGGCCTTGATGATCACGACGTTACTGGTGCAGGTGAAGT
GCTTCCAGGAGATCATCTCGATTGGCTACCAGGTTTATCGAATTCATGGCTTGCCCTGGTTCCGAAGCCTTTCCTGGTAT
TTCCTGCTTACCTCAAATTACTTCTTTTACGGAGAGAATCTGGTAGACTACTTTGGCGTTGTAATTAATCGGGTGGAATA
TCTGAAGTTCCTGGTGACCTATCACCGGTTCCTTTCCTTCGCCCTGTACATCATCGGGTTCGTTTGGTTCGTGCTCTCAC
TGGTGAAGAAGTATTACATCAAACAATTCAGCCTGTTTGCCTGGACCCATGTATCCCTGCTGATTGTCGTCACCCAGAGT
TACCTCATCATACAGAATATATTTGAGGGGCTCATTTGGTTCATCGTACCTGTTTCGATGATAGTGTGCAATGATGTCAT
GGCGTACGTGTTCGGTTTCTTCTTTGGGCGCACTCCCCTCATCAAGCTCAGCCCCAAGAAGACCTGGGAGGGCTTCATCG
GGGGTGGCTTCGCCACCGTCCTCTTTGGCATTCTGTTCTCGTATGTGCTGTGCAACTACCAGTACTTTATCTGTCCCATC
CAGTACTCGGAGGAACAGGGACGCATGACAATGTCCTGTGTGCCAAGCTATTTGTTCACGCCCCAGGAATACAGCCTTAA
ATTGTTTGGCATTGGCAAGACTCTAAATCTTTACCCCTTTATCTGGCACTCGATCTCCCTGAGCCTGTTTAGTTCCATTA
TTGGACCCTTTGGTGGCTTCTTTGCCTCTGGATTTAAGAGAGCTTTCAAAATTAAGGACTTTGGCGACATGATACCCGGA
CATGGCGGCATTATGGATCGTTTCGATTGTCAGTTTCTTATGGCGACCTTCGTTAACGTTTATATATCCAGCTTCATCAG
AACTCCGTCGCCGGCTAAGCTGCTGACACAGATTTACAACCTTAAGCCAGATCAACAATACCAAATTTATCAGTCCCTCA
AGGACAACTTGGGCGACATGTTAACCTAAACTTGATCGGTTACCAGTAAGATTCGGACAAGACGTTTGCTGAGTCGTACG
TTCTATATGTAATGCAGAAATTTCTATATATATACATTGATATATATCTGTAAGCAAACGGGCCGGCAGTTTGAGCAGCC
ACATAAAATAAGTTAATTACGGGCATAATTTTTGTTATGTTATTAGTCCTTAGTTAGATTTTGTTGCTACATTTTAGTTA
AATTCTTAAGTTAGTTTTTATTTTATCTTGCATTAAGTTATTGCGATTGTTTTATTTGGCAGAACTCTACACAGTGCAAT
CGTATTGTTAAGCGATTCCATTAATTTTAATGCCCTCGTGACAAGGCGTCAAGGCAAGGCAAACAGAATAACTATGAATT
TAATATCGACTATGTGTGTGTGCGTGTTGTTAGTGAATTTAATTACGATAACTATAGCTTAGAGATGATCAGGCAGACAA
CGCCAGAATCTGGAGATTAGCATAATTAAAGCGCATTTTAGTTAAATACCTGAGGGACGAAATTATGAGATCAAGATACC
AGGAAAACTCTTGCAATGCTGTAATTCTATATATAATAGTGCAATATGCAGACGTTAAATAATTGATTTAACCATTTCAA
TATTTATTTATTTACTTTTATTCGGTCATACACTACGCCATGCATAGTGCAACATCCTCAACCCGTGAATCTTTCTCAAA
AAGTACATAGATGATATATAATCGGTTACTTATAAATCCTGTTATACTGTACGGCATTTAAGAACGAAAATGCAATTCGT
CGGCGTTTTAAAGAACTAAATGTACAAAGATTTCAATATTAAATCTTACAGTCTCTATGTTAAATATATAT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0346546
2609
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0076411
447
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0312164
447
Comments
Transcript terminates at site supported by polyadenylated cDNA.
External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (3)
Reported As
Symbol Synonym
CG7962-RA
Cds-RA
Secondary FlyBase IDs
    References (2)