General Information
Symbol
Dmel\Arr2-RA
Species
D. melanogaster
Annotation Symbol
CG5962-RA
FlyBase ID
FBtr0076599
Feature type
Associated gene
Evidence Rank
Length (nt)
1547
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 992 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    Sequence
    GTTTCGCATTTTCCTCCGCCGAACGGAAAACTCTATAACGCGCATCGCCCGACTTAGCCTCGAATTGCCCAGTTGCATTT
    GCCAGGAATCAAAGAAATCCACTAATCCACAATGGTTGTATCCGTGAAGGTCTTTAAGAAGGCCACGCCCAACGGCAAGG
    TCACCTTTTATCTGGGACGCCGCGACTTCATCGACCACATCGACTACTGTGATCCCGTCGATGGAGTGATTGTGGTGGAA
    CCGGACTATCTAAAGAACAGGAAAGTCTTTGGCCAACTGGCCACCACCTATCGCTATGGTCGCGAGGAGGACGAGGTCAT
    GGGAGTGAAGTTCTCCAAGGAGCTTATCCTGTGCCGGGAGCAAATTGTGCCCATGACCAATCCCAACATGGAGATGACAC
    CGATGCAGGAGAAGCTGGTCCGCAAACTGGGCAGCAACGCCTATCCGTTCACCTTCCACTTCCCGCCCAATTCGCCCAGC
    TCCGTTACTCTGCAGCAGGAGGGCGACGACAATGGCAAGCCCCTGGGCGTCGAGTACACCATCCGGGCATTTGTGGGCGA
    CTCCGAGGACGATCGCCAGCACAAGCGGAGCATGGTCAGTCTGGTGATCAAGAAGCTGCAGTACGCTCCCCTCAATCGTG
    GCCAGCGTCTGCCCAGCTCGCTGGTCAGCAAGGGATTCACCTTCTCGAATGGCAAGATCAGTCTGGAGGTTACGCTGGAC
    AGGGAGATCTACTATCATGGCGAGAAGACGGCTGCCACCGTCCAGGTGTCGAACAACTCCAAGAAGTCCGTGAAGAGCAT
    CAAGTGCTTCATTGTGCAGCACACTGAGATCACCATGGTGAACGCCCAGTTCAGCAAGCATGTGGCCCAGCTGGAGACCA
    AGGAGGGCTGCCCCATCACTCCGGGCGCCAATCTCACCAAGACCTTCTACTTGATTCCGCTGGCGGCTAACAACAAGGAT
    CGCCATGGTATCGCCCTGGATGGTCACTTGAAGGACGAGGATGTCAACCTGGCTTCATCCACCATGGTGCAGGAGGGCAA
    GTCCACGGGAGATGCCTGTGGTATTGTCATCTCGTACTCGGTGCGCATTAAGCTCAACTGCGGCACTCTGGGAGGTGAAA
    TGCAGACGGATGTGCCCTTCAAGCTACTCCAACCGGCACCTGGAACCATTGAGAAGAAGCGCTCGAATGCCATGAAGAAA
    ATGAAGTCCATCGAGCAGCACCGCAATGTGAAGGGCTATTACCAGGATGATGACGATAATATTGTATTCGAGGACTTCGC
    CAAGATGCGCATGAACAATGTGAACATGGCGGACTAGGCCACCGATCTTCAATCTCTTCTAGCTCTGTTGTGAACCGAAT
    TGAACTAAATCGAAAGCACTGAAAATTTGTTGCAGCAGTCTCTCGTGGAGGCCACAATCTTTGTATTATAATCGTATCTA
    TAATGTAACTTTGGTGGATCTGGAGTTTGTACCCGTACATATGCATGTTGATGAGTTGAACAGACCTCGTGTCGCTATAT
    TATAAATGTGTTATGGCTATCAAAAGC
    
    Other Products of this Gene
    Other Transcripts
    Polypeptides
    Derived from THIS transcript
    Name
    FlyBase ID
    Length (aa)
    FBpp0076326
    401
    Derived from OTHER transcripts
    Comments
    Transcript terminates at site supported by polyadenylated cDNA.
    External Crossreferences and Linkouts ( 1 )
    Crossreferences
    RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
    Synonyms and Secondary IDs (2)
    Reported As
    Symbol Synonym
    CG5962-RA
    Secondary FlyBase IDs
      References (2)