General Information
Symbol
Dmel\pix-RB
Species
D. melanogaster
Annotation Symbol
CG5651-RB
FlyBase ID
FBtr0076558
Feature type
Associated gene
Evidence Rank
Length (nt)
2184
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 66 )
Sequence
TCATATAGGCGGCTGATTAGTGGATCGAAGCCAATTCTGTTTAATTTGCTCATTTGAAAACTATCAACAGCATGTCGCGC
AGAAAGGAGAACGAGGAGGTGGACAAGCAGACGCGTATTGCCATCGTCAGCGATGACAAGTGCAAGCCCAAACGGTGTCG
GCAGGAGTGCAAGAAGACCTGCCCAGTGGTGCGCATGGGCAAGCTCTGCATCGAGGTGACGCCCACGTCCAAGATAGCCT
CGTTGTCCGAGGAGCTGTGCATCGGTTGCGGTATTTGCGTCAAGAAATGCCCCTTCGAGGCCATCACAATCATCAACTTG
CCCAGCAATCTGGAGAAGCACACAACGCATCGATACAGCAAGAACTCCTTCAAGCTGCATCGTCTGCCCATTCCGCGTCC
CGGTGAAGTGCTCGGTCTTGTGGGACAGAACGGTATTGGCAAGTCGACCGCTTTGAAGATCCTCGCGGGGAAACAAAAGC
CGAACCTGGGGAAGTACGCCAATCCGCCCGACTGGACGGAGATCCTTAGCTACTTCCGCGGCTCCGAGCTGCAGAACTAC
TTCACCAAGATCTTGGAGGACAATCTGAAGGCGCTGGTCAAGCCGCAGTATGTGGATCAGATCCCCAAGGCGGTGCGTGG
CGCTGTGGGCGATCTTCTGGATAAGAAGGACGAGAGGGAGCTGCAGACTAAGATTTGTGAAATGCTGGATCTATCGCACA
TCCGTGATCGTGAGATCGCTCAGCTTTCTGGCGGAGAACTGCAACGCTTTGCCATCGCCATGGTATGCATACAGAATGCA
GACATCTTCATGTTCGACGAGCCGTCCTCGTATTTGGATGTTAAGCAGCGTCTGAACGCTGCCTTGACCATTCGATCACT
CCTGCATCCCACCAAGTTTATTATTGTGGTGGAGCACGATTTGTCTGTGCTGGATTACTTGTCTGACTTTATATGCTGCC
TTTACGGAGTTCCCGGCTGCTACGGTGTGGTTACTATGCCTTTCTCTGTGCGCGAAGGCATCAACATTTTCCTCGATGGC
TTTGTGCCCACCGAAAACATGCGATTCCGCACTGAGTCACTTACTTTCAAAGTATCTGAGTCCGCTACGGAGGAGGAGAT
CAAGCGCATGAACCACTACGTATATCCCGCCATGGTCAAGACCCTGGGCAAGTTCGAGTTGACGGTGGAAAAGGGTCACT
TCAGCGACTCCGAGATCCTGGTGCTCCTGGGCGAGAACGGTACAGGAAAGACGACGTTCATTCGCATGCTGGCCGGTAAC
CTCCAACCCGATGGCGAGGTGGAACTGCCTATGCTGAATATTTCCTACAAGCCCCAGAAGATTTCCCCGAAATTCCAAAA
TCATGTTCGCCATTTATTGCACGATAAGATTCGTGACGCCTACGTGCATCCTCAGTTTATTGCCGATGTTATGAAACCCA
TGAAAATTGAGGAAATCATGGACCAGGAGGTGCAGAACCTTTCCGGTGGTGAGTTGCAGCGAGTCGCCTTGGTCCTGTGT
CTTGGCAAGCCAGCGGATGTCTACCTCATCGACGAACCCTCTGCCTACTTGGATTCAGAGCAGCGTCTGGTGGCCGCCAA
GGTTATCAAACGTTACATTCTGCACGCCAAGAAAACTGGATTTGTGGTGGAGCACGATTTCATCATGGCCACCTACCTCG
CCGACCGTGTCATCGTGATCGAGGGTCAGCCTTCAGTGAAGACGACAGCCTTTTCGCCGCAGTCGCTGCTAAATGGCATG
AACCGCTTCCTCGAACTGCTTGGTATTACGTTCCGTCGCGATCCCAACAACTTCAGACCCCGCATTAACAAAAACAATTC
GGTCAAGGACACAGAACAGAAACGCTCCGGCCAGTTCTTCTTCTTGGAGGACGAAGCCTGCAACTAAGACAGGATCACGG
GCAACTTCGATGGGACAGCTCGTTTCTCTATGTTCTCCTCAGCTTTCCTTCGTTCATTTTGCATTCTTTCGTTGAAGAAC
ACATTTGCTTTCAAATTAATTTGTTATTGTTGTCGAGGATTGCGTACAATCGAAAATTGGGGATTAATTGTACTTGATTA
AAGTGAGTTTTATATACGTTTTTACAGCGAAATAAATAGTGAACCGAAACAACAGAATGTTGTTTTAAATGAGTCTAGCA
AAAATAAACCAATTTTCTTTATAC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0076557
2223
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0076285
611
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0076284
611
Comments
Transcript terminates at site supported by polyadenylated cDNA.
External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG5651-RB
pix-RB
Secondary FlyBase IDs
    References (2)