General Information
Symbol
Dmel\CG6409-RA
Species
D. melanogaster
Annotation Symbol
CG6409-RA
FlyBase ID
FBtr0076273
Feature type
Associated gene
Evidence Rank
Length (nt)
1212
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 105 )
Sequence
GATCAGCAGTTTGGGTCACATCTCCAAGCGGTCAGCATGAAGTCGGTTATTATTCTCTTAGCCCTGGTGGCTTTCTGCCA
CGCAGCACCTCTGGATGTCAAGGAGTCTACCTCTGAGGAGCTCTCTAGGCCCAGTCCCATCAGCCCCGATGTGCTCGTTG
ATCCCAAGCCCACCGCCAAGGTAGTCTTGCTGAAGGATGCTCCCGTCCTGAATCGCCAGAGGCGTAATGAACCCAAGAAG
CCCGACAGCGTGGAGGCCCACGAACAGCTGCATCACTCGCAGCCGGCCGTTCCTATTCATGACCAGAAGCCTTCTCCGGC
TGGGCCACAGGACCACAAGCGCAAGAGGGAAGCTCACCACGAGGAGGGTCACCATGGTGACGATGCAGTGCCCCAGAAGG
AGGAAGTGAAGCAAGCTCCCGAGGACCATGACGCCAAGAAGGAAAAGAGAGAGGCTCACCATGAGGAGGGTCACCAAGAC
CATGAGGCTCCTCATAAGGAGGAAGTGAAGCAGGCCCCCGAAGCTCATGATGCCAAAAGGGAAAAGCGAGAGGCTCACCA
CGAGGAAGGCCACCATGGTGATGATGCAGCTCCACATAAGGAGGAAGTGAAGCAGGCTCCCGAAACACATGAGGACAAGA
AGGAAAAGAGGGAAGCTCACCACGAGGAGGGCCACAAGGATGAGGCAGGTGATCGTCCTCAGGTGGAGGATCTTTCGCTG
CCCCATGCCCTGCCCGCTGTGGCCCACACCGCCGAGCTGCCCAAGAAGCAGGAAAAGCGCGAGACTGTGGAGAAACCCGA
CAGCGTGAAGGCCCGTGAGTCGCTCCAGCACAATCCCCAGCGATCCCAGGAGCTCCACAAGGCCATCGAATCTCTGGCCG
GTGGAAAGGCGCCGGAACAGCGTCACCAGCGCGATATTCCCGTGCCCACGCAAACCAAAGCCACCACCACCACCGATCTC
CCATCCACCACCAAATCGGAGCTGGAAAGCACCACTCCGTCCATCCACAATCTCCACATCCCCCATCCCATTCCCGTGGC
CGAGCTCTTCGAGAAGAACAAGCACGCGGATAAGTCCACTTCCAGTTCCGAGGAAAGCAAGGAGAAAGCTAAGGCCTAGG
CTTCCTATGTTAAGAGTCGCTAATGGGACCATCACGAGATTTGTAGTCAGCGAAACGAACTAAAATAAACACAAATATTT
ACATGCTTATAT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0346544
1544
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0076002
360
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0312162
360
Comments
Transcript terminates at site supported by polyadenylated cDNA.
External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
CG6409-RA
Secondary FlyBase IDs
    References (2)