General Information
Symbol
Dmel\CG7841-RA
Species
D. melanogaster
Annotation Symbol
CG7841-RA
FlyBase ID
FBtr0075604
Feature type
Associated gene
Evidence Rank
Length (nt)
1377
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 64 )
Sequence
AACATTTCGTTATGCGATTTGAATGGGGCAGTTGCATTGGAGCCTCGTCCGCCGAACACAGAACATTACAAACGCGTTTC
CAGGAGTAATTGTCGGTGATTTTAATCGAAAACAATTGATACGAGCGCGGTGCGGCAGCCATCAAAATCAAAGAGTGCTA
AATCGGAATCACTGCCCTAAGTGAAGTGTATTGTGTAACCTTTTGAGACGATGACAATAGGCCAAAAGGAGGCGGCGTGG
GGCAGGCTGGGCTGCCAATGATCATATGATTGCCTAGAGCGGAAAAATACTCAAAATCATAGCAGTCGGCTAGGCATTTC
GTTGCCAGAAACGAAAACAACAATACGTAAATCGAAAGGACAAGGTATATTTTCAGCCGGTACTCCCCATCTCCCCACCA
CCATGTACACAATCAACAAGGGACCTAGCAAAATTGTTGCTAAAACGCGTCGCGGCCTGGCACCAAATTTTGAAAAATTC
GAAAGCATCAAGGAGAGCGGCCGCAAGAACGCTAGTTTCGATCTGAACAGTCCCGAGGAGCACAAAAACATACCGCGTCC
GGTGTTTCAACAGAGCTTCGCCACCAAGCGGATAACGCCAACCAAACTGATCGAGGATGAGGTGATAACGCCGCAACATG
AGGAAATAATACGTTACATAAATGACTCCTGGAACATGCTGGTGGCGCAGAATCCCTACGACTCGAGCTCATCCGCCAAG
CCTGTTGAGAAACCTGTAGCGGATGCCAACAACAACAGCGCCGCCAGTCCAGTGGAAAGCATAATGGCCAACAGCCCAGT
GCCCGCTGCCTCGACAGCCACTGTCTGGGTGGAGCCACCGAGTCCAGCGCTACAGGACTTCAAGCCCTTCGACCTGGAGT
CGTGGTGGGGACGTCGCCTCTTCCAGAACATAACCAAAAGCCTGTAGGACCGATCGCATGGGATCGAATGAGTGGCAGAG
CCTGATCTTTGTCAATTCCTAGATAGTCAGTGCTTCCTTCTGTGCATGTACGTTCGACTGGACATGGGCAAAATCACACT
AGATGATAGTGGGCGAAACGAGATGTGACGAGAGACTTGCTTAGTTTTCGGCTAGCGACTAAGTAAATATCACTTTGGAT
GTTAGTGGTTGGGAGGCCACCGTGGTGGCAAATCTTGGCATAGGTTCATCTCGCATATAAGTGTGTATATGAAGTAAATT
GAGAGTCGTCGCCGTTGGCCAATGTAAATAATACGATTTCTGATTTACAATTAAGAATGTGTTATAGAGTTATAAGAAAC
GTGTCATCTGGATGGCTTGCCATTTTTTTTTTAATGTCAACAACACTCATGTGAATTGTATAAAGTATAAGGTTCAAACT
AACATCAATTTAATTGC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0334085
1628
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0075357
174
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0306210
174
Comments
Transcript terminates at site supported by polyadenylated cDNA.
External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
CG7841-RA
Secondary FlyBase IDs
    References (2)