General Information
Symbol
Dmel\Taf4-RD
Species
D. melanogaster
Annotation Symbol
CG5444-RD
FlyBase ID
FBtr0075451
Feature type
Associated gene
Evidence Rank
Length (nt)
4166
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 60 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TTGTCGCCAACGGTCACACTGCACAACTCGTCCGTACCTCGGCGGTCCGTAAACAATATTTACTCGGTTTTCGGCTAAAT
        CGCCAGAGAAACGCAACGGGAAATCGTTTAAAATGCGCCCCAGTGCACCGAGTTTGAACGCAAAATGAATTGAATTCGCT
        TCTGGAGCGCACAGCATGCAACAACTCCGCCAACACCAACACAGGATGTGCGCAACTAGTTGATCGGAACAGGATCGCTC
        GCCCACACCAACACACAGAAGTCAGTGGAATAGGAGAAACACACTCGCCAATAACATAAACACCACACAGCACGATGAAC
        ACCAGCCAGACAGCTGCCGGCAATCGCATCACCTTCACCAGCCAGCCGCTGCCCAATGGCACCATCAGCATAGCCGGCAA
        TCCCGGCGCGGTCATCTCCACGGCCCAGCTACCGAATACCACCACCATCAAGACGATCCAGGCGGGGATCGGTGGTCAGC
        ATCAGGGACTTCAGCAGGTGCATCATGTCCAACAGCAGCAGCAGTCGCAACAGCAACAACAGCAGCAACAGCAGACGCAA
        TCCGCCGGTCAACCGCTGCTCAATTCAATGCTGCCGGCTGGCGTGGTGGTGGGCATGCGCCAACAGGCGCCGTCACAGCA
        GCAGCAGAAGAATGTGCCCACCAACCCGCTCAGTCGCGTGGTGATCAACTCCCACATGGCGGGCGTGAGACCGCAGAGTC
        CATCGTCTATGACCAACACGACCGCCACCAGCAACATCATTGTCAATTCGGTGGCAAGCAGTGGATATGCAAACTCTTCG
        CAGCCGCCGCATCTGACGCAACTAAATGCGCAGGCGCCACAACTGCCGCAGATTACGCAGATTCAAACAATACCGGCCCA
        GCAGTCTCAGCAGCAGCAGGTGAACAATGTAAGCTCCGCGGGAGGAACGGCAACGGCGGTCAGCAGTACGACGGCAGCGA
        CGACGACGCAGCAGGGCAATACCAAAGAAAAGTGTCGCAAGTTTCTAGCCAATTTAATTGAATTGTCGACACGGGAACCG
        AAGCCGGTGGAGAAGAACGTGCGCACCCTCATCCAGGAGCTGGTCAATGCGAATGTCGAGCCGGAGGAGTTTTGTGACCG
        CCTGGAGCGCTTGCTCAACGCCAGCCCGCAGCCGTGTTTGATTGGATTCCTTAAGAAGAGTTTGCCTCTGCTACGACAAG
        CCCTCTACACAAAGGAGCTGGTCATCGAAGGCATTAAACCTCCGCCGCAGCACGTTCTCGGCCTGGCCGGACTCTCTCAA
        CAGTTGCCTAAAATCCAAGCGCAAATCCGTCCGATCGGTCCTAGCCAGACAACGACCATTGGACAGACGCAGGTGCGTAT
        GATAACGCCGAATGCCTTGGGCACGCCGCGACCCACCATTGGCCACACCACGATATCGAAGCAGCCACCGAATATTCGGT
        TGCCTACGGCCCCGCGTCTCGTCAACACTGGAGGAATTCGCACCCAGATACCCTCGTTGCAGGTGCCTGGTCAGGCGAAC
        ATTGTGCAAATACGTGGACCGCAGCATGCTCAGCTGCAGCGTACTGGATCGGTCCAGATCCGGGCCACCACTCGTCCGCC
        AAACAGTGTGCCCACCGCGAACAAACTCACTGCCGTCAAGGTGGGACAGACGCAAATCAAAGCGATTACGCCCAGCCTGC
        ATCCACCCTCGCTGGCGGCAATCTCAGGTGGACCACCGCCGACACCCACGCTGTCTGTTTTGTCTACGTTGAACTCCGCC
        TCGACCACAACGCTGCCCATACCATCGTTACCCACGGTCCACCTTCCCCCCGAAGCTCTTCGAGCCCGTGAGCAGATGCA
        AAATTCGCTGAACCACAACAGCAATCACTTCGATGCAAAACTGGTGGAGATCAAGGCGCCGTCGCTGCATCCGCCGCACA
        TGGAGCGGATCAACGCATCTCTCACACCGATTGGAGCCAAGACGATGGCAAGGCCGCCGCCTGCGATCAACAAGGCGATA
        GGCAAAAAGAAACGCGACGCCATGGAAATGGACGCCAAATTGAACACATCGAGCGGAGGAGCGGCGTCCGCTGCGAACTC
        GTTTTTCCAGCAGAGCTCCATGTCCTCGATGTACGGTGACGATGATATCAACGATGTTGCCGCCATGGGAGGTGTTAACT
        TGGCGGAGGAGTCGCAGCGAATTCTCGGCTGTACCGAAAACATCGGCACGCAGATTCGATCCTGCAAAGATGAGGTATTT
        CTCAATCTCCCCTCGCTGCAAGCTAGAATACGGGCAATTACTTCGGAGGCGGGACTGGATGAGCCGTCGCAGGATGTGGC
        CGTTCTGATATCGCACGCCTGTCAGGAGCGCCTGAAGAACATCGTTGAGAAGTTGGCTGTGATAGCGGAGCACCGCATTG
        ATGTCATCAAGTTGGATCCACGCTATGAGCCCGCCAAGGATGTGCGCGGTCAGATCAAGTTTCTCGAGGAGCTGGACAAG
        GCCGAGCAGAAGCGACACGAGGAACTGGAGCGTGAGATGCTGCTGCGGGCAGCCAAGTCACGGTCGAGGGTGGAAGATCC
        CGAGCAGGCCAAGATGAAGGCGAGGGCCAAGGAGATGCAACGCGCCGAAATGGAGGAGTTGCGTCAACGAGATGCCAATC
        TGACGGCGCTGCAGGCGATTGGACCTCGGAAAAAGCTGAAGCTAGACGGCGAAACAGTCAGTTCGGGAGCGGGTTCAAGT
        GGCGGCGGAGTGCTAAGCAGCTCGGGATCTGCGCCGACGACGTTACGGCCTCGCATAAAACGTGTGAACCTGCGCGACAT
        GCTCTTCTACATGGAGCAAGAGCGGGAGTTCTGTCGCAGTTCCATGCTGTTCAAGACATACCTCAAGTGATCGCTGCTGT
        TGCCCATCAATCGCACCGTCTTCTCCTCGCCGATCCTCCTACTCCGTGGACTGTCGTGTTGTTGTTTTATACAGCTTTAC
        GATTTCATCCACTTGCAATATATTTTAGCCTCAACTTTAAATGCGTCGCGTGTCCCCTGTTGTTGTTTCTTTTTAGTTAG
        GCGGCTCTATTTAATTTCTATTTTTACATTTATTTACATAAATCCTAAATTCTAATCGTATTTGATTTTAAGCCTAATTT
        AAAGCTCGTTTATTTTTCCAATAAATTCTCTGTAAAACTTAAACCAAACCAATCCAAAAACAAAACAAAACCAGAGTAAA
        CGAAGAGAATAAAATAATAGAGAGGAAAGTAAAAGAAGGTAAAAGAGAGCGCGCAGTCAGCGGGCGTTTGATTTGTAATT
        TGTAACATAATAATGTTTGCATCAACTGCATTGACGGCCTTATCTAAACGATATAAACATAATTATTAATATTTAATTAT
        TTAGCTTAGTTTGTTAAACGAAAACGAACCATAATTCCTAGATTTTAAGTAAAAAGCAAGGGCGCGTGAAGAGAAATCGA
        AACCGAATTACAGATAAAGGTTTTTAAAACCAACTAGATCGAAACAAGTTCAGCAACAGCAAAACAAAAGAACACATCAA
        AAAAAGAACCGAAAAATATCCATTTAAACATCCATTGAATTAGGTTTAGTTGTTTAAAAAAGATGTAATTTTTAATTACC
        CATAATGTATAAACGGAAATCAATCGTTAGGCAAGACCACAACAAACCCAACAAATTGTAAATACATTCTAGGCTACGGT
        TTTTCTAATAGATAACTAGGTAAAAACGCAAACGTAATTAACAAATTATCGATGGCAAGGAGCGATGCGAGCGCAGACAA
        CTTGGCACACCGAAAAAATATGTTTTTATTAGTGGCGCTCGTTCATCCATTAAGAATGGCGATTCATTAGGCTCCATAGA
        TCCATAAATCCCCTAATCCAATCTGAACTACACACAAAATAGACAAATTTTATACAATTAGCTCGATAAATCTTGTAAAA
        TAGAGTCCCGTAAAAAAATTATAACAAATAAATTGACAACAATTGATGTAATTCAGTAAACCTAAGCAAAAAGTGAAACC
        ATTCTAAGCAAATTCTTTGTGTGTAAAAATTAATATGATAAACAAAATGCAGATGCAACCGTAAACAGCGCATAGTTTGG
        TAGGCATATAACTGAATATATATATATTATTATTATTATGTTTTAACATTAAGCAAAAAAATAAAAGAAAAAATTGAGAA
        AACTTC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0075448
        4916
        FBtr0075449
        4574
        FBtr0075450
        4423
        FBtr0114589
        5134
        FBtr0301911
        4622
        FBtr0333290
        4756
        FBtr0333291
        5011
        FBtr0345951
        4226
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0089259
        851
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0075205
        921
        FBpp0075206
        921
        FBpp0075207
        851
        FBpp0113081
        1088
        FBpp0291125
        921
        FBpp0305485
        962
        FBpp0305486
        1047
        FBpp0311865
        921
        Comments
        Transcript terminates at site supported by polyadenylated cDNA.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG5444-RD
        Secondary FlyBase IDs
          References (2)