General Information
Symbol
Dmel\Mipp1-RA
Species
D. melanogaster
Annotation Symbol
CG4123-RA
FlyBase ID
FBtr0075399
Feature type
Associated gene
Evidence Rank
Length (nt)
1828
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 142 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CATCAGTTTCATTTTGAGCGTTCAACGGTCGCGACGTCGTGAGCGGTCAAGTCGCTTGAAACGGCTAAGGGAAAACTACT
        GCCCAACTTCAATTGTTTACCAAGTGCATTTAAATTACCAACTACTAGAGCTATGCGCCTGCTGATATTGCTACTGCTGC
        CACTGGTGGCCATCGCCCAAGATGACTACTGCTTCAGCAAGGACACCTCCCGCCTCCAGACCCGCCAGTTCTCCTCGAAG
        ACCGCCTATCAGATCGTCAAGGGCACGGACATTGACAAGCAGTACCTGGTGCCCGGCTGTCAGCCCCAGAAGATGTGGAT
        CTTTCACAGGCACGGCACACGACTGCCCAAGAAGAGCATGATCAACAAGGCGTCCAGGGTGGCTGAGCTGCGCGATCTCA
        TCATTAACAACTACCAAGTGGCCAGGACCAAGCCCGAAACGGATGCTCTCTGCCAGACGGATCTGATTGCCATCAAGTTG
        TGGAAGTGGAACAGCAGCATAACGCCCGACATGGAGGAGTATCTGACCGCCCAGGGCTACGAGGATCTCAGGGGCACGGC
        CAAGCTGTACCAGCGGTACTATCCCACTGTGCTGACCGCTAACTATAATGACACTTACTACCAGTTCCGCCATACGGACA
        CCCAGCGCACCACGGAAAGTTTCAAGGCTTTCGCCGAGGGTCTGTTTGGATCCCAAAACGCTGCTCATCCCGTCGAGATT
        CCCAAGCAGGATCTGCTGCTGCGTCCCTATGACTATTGCTCCTCTTTCAAGAATGTGAACTACAAGGATGAGGGCTCTGA
        GTACTACAAGTTTCATCAGTCGAAGCTGTACAACGACACGTTGGCGGATATCTCCACTCGATTGGGTTTCCTTTACACCC
        TGGAGGAGGCGGACATCAAGCTAATGTACGATATGTGTCGCTATGAGCAGGCGTGGAATGTGGACCGCAATAGCGTCTGG
        TGCGGCGCCTTCTTGCCGGAGCAAATAACGGTCTTTGAGTACCTGGAAGATCTAAAGTACTACTATGGCTCGGGCTATGG
        TTTCCCGGAAAACGCACATCTCAACTGCCGACTGGTGCAGGACCTGCTCACCCACCTGAGCAATCCGGTGTCGCCGCATG
        TGGTAGCTCATTTCGGTCACTCGACTGGTCTCCTAACTCTCCTAACTGCGCTGGGAATCCAGAAGGACGACATCAAGTTG
        CGGGCAGACAATTACGATAGTTTGACGAGCCGCCGTTGGAAGAGCAGCCTGATCGATCCGTTTGCCGCCAATTTCGTGGC
        GGTGAAATACGACTGTCCGGCGGACTTGGATCGCGAGAAGGTGGTCTTCTTCCTCAACCAGCAGGCCGTGCAGCTGGACT
        GGTGCAGCGTCGGTCTGTGCAAGTGGTCAGATGTCCTCGAGAAGTACAAGACCATTGCGGATGCGGATTGTGGAGAATAC
        TACTGCCGGACGGGAGGTGCTCCATCGCTGGGATCCGGAGTTGGCGGACTTCTGGCCACCACGCTCGCCGCCATGCTGGT
        CTACTTAATGCACTAACTTTCGATTAGATTAGTTTTTAATTCGTAATGTACAAATTTCGTACCAAATGGAGGGACGCCAC
        GCGGCGGATGTCAGTCAAGTATTTTTCGATTTAGATTTTTTTACTTTTAATCCAGCAACAGCACAATTCTTCACACAGTC
        AAGAAGTCACACTACACACAAAAAACACACACAACCAGATACTGAAATGTTCAACTTAACGATTTTTCTAAACGCTTAAT
        GAACGTTGATGGCGCTCCAGTCAGAATTAGCTTTATATTAACTGAATAAAATGAGTCTTTAAAATGTG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0075398
        1769
        FBtr0345813
        2009
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0075157
        467
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0075156
        467
        FBpp0311799
        467
        Comments
        Transcript terminates at site supported by polyadenylated cDNA.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (3)
        Reported As
        Symbol Synonym
        CG4123-RA
        CG4123-RB
        Mipp1-RA
        Secondary FlyBase IDs
          References (2)