General Information
Symbol
Dmel\ftz-f1-RB
Species
D. melanogaster
Annotation Symbol
CG4059-RB
FlyBase ID
FBtr0075086
Feature type
Associated gene
Evidence Rank
Length (nt)
5407
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 102 )
Sequence
ACTGTGTGTTGTGTTCCCGTTCGAGTTCGACCTAATTTCGCTCGAGACCTAATTTTTGCGTGCGGAATAGTTTTTCCCGA
AAAAGTGAAGCCAGCGAATAAACAATAGCTGAAAGTGAGCGATAGCCAAGAAAGTAAGAGTGAAAGTAAACAAAAGCGAA
AAGAAGAACAGCTCTGGCGTTAATTATGTGTGTGTACATACGTATATATTTAATATTTCCGATGCGTCCATAACGGGAGT
GTGTTCTGGTTTCCAATCGTCGCCCGCGCCCCCGTCATTGCCTATCCGTTTACCAAACCCCAATTTTGGTGTGCAATTGT
GTATAAAAATTAACACAAAGTGGGAAGATAGCGTTGTGTCATAGAATTGGAGCAGAAGCAAAAACAAGGCAAAATTAGCA
AAAGCCAAGCGGAAAAACAACAACACAGAGTGCCCAGTGGAACCCCAGTACATGTGTGTATATATGTATGTGCGGTGCGA
GCGTGTCAGTGTGTGCGTAGCAGGAATTGCAATTTATAGTTGTTGTTTCTGAGAGCTTTCGCTTGTTGCGCGCGTGCGAC
GATTGTGCAAGAAGTTCTTGGTGTGCGTTCGAAATCGGGAAGAGGAAATCGCCGAGAATAGAGGAAGAGTAAATGGCAAT
AAATGCAAAATAAATAAAAGAAATAAATAAAAAAAAATATAAATAAATTGCCAAATGCGTTTGGCGTCGCGTGTGTGTGC
GTGTTCTGAAATATGCTGAAAGAGCTTTCGGAGAGCGAGAGCAAAAGAGAACGAGACGCCGAGAGATGCGATCGGGAGAA
ATAGCAACAACAACAACAACGGCAACAGCGACTACGATCGGCGAAATGAATCACACACAAGCTTTGTTTTGCGAATTATA
AATTCGCGTTCCGTTCTCCACACATGCGAATTCCCACACTGAGAGCGAGACAGAGACAGCGAGAGAGAGGGAGACCAGCT
ACGGCTACAAAAACAGAAACAGCAAGAAGACCAAGACATAATAATAGAACTTTTGCTTTCGCTTCCAACTGGTTTTTGTA
TACATAAAAAGCGAGAGGGGAAGAGACGGAGAAAGAGAGAGACGGACAGCTTCCAGCGCTTCTTCTTCTTCCGCGATCTT
CGTCTTGGAATTCATGGAACCGGGCGCATGCGCAACACACAGAACTACAAAAGGAAAAACAACGACGTCAGCTGCATGAA
AGGTCTTTAAAGCAATTATAAACTTACAACTACTATCGTTACCTGCCATTAAGAATCAACAAAACAAATACCACACATCA
CAACGAAACGTACAAAAAATAAAAGTTAAATTATATTATTCATAAAATGGATACCTTCAATGTACCTATGCTGGCGGAGA
GCAGCAACACCAACTATGCAACAGAAGCTACCAGCAATCATCACCACCTGCAACATCAGCATCAGCAGCAACATTCACAT
CAGCAGCAGCAGCAGCAGCAACTCCTAATGCCCCATCATCACAAGGATCAAATGCTGGCGGCGGGCAGTTCGCCCATGCT
GCCATTCTATTCACACTTGCAGTTGCAACAGAAGGATGCAACTGCAACAATAGGACCTGCAGCAGCAGCAGCAGCAGTTG
AGGCGGCAACAACATCGGCAAATGCCGATAACTTCAGTTCATTGCAAACGATCGATGCCAGTCAACTGGATGGAGGCATC
TCCTTGAGCGGCTTGTGCGATCGTTTCTTTGTGGCCAGTCCAAATCCCCACAGCAATAGCAACATGACACTAATGGGCAC
TGCCACAGCTGCAACAACTACCACTACCAACAACAACAATAATAACAACACTAACAATAACAATAACAACAACGTGGAGG
CTAAGACAGTGAGGCCATCGAACGGCAATTCGGTGATCATCGAATCTGTGACGATGCCATCGTTTGCCAATATTCTATTT
CCCACCCATCGCAGCGCCAACGAGTGCATTGATCCCGCCCTGTTGCAAAAGAATCCCCAAAATCCAAATGGCAACAACAG
TAGCATAATTGTGCCGCCCGTCGAATATCATCAATTGAAACCACTTGAAGTCAATTCGTCGACTTCCGTTTCCACCAGCA
ACTTCCTGTCCTCCACAACGGCCCAATTGTTGGACTTTGAGGTGCAGGTGGGCAAGGATGATGGCCACATTAGCACCACT
ACGACCACAGGGCCGGGCTCTGGATCGGCATCGGGTTCAGGATCGGGATCGGGATCGGGATCAGGATCGATTGCACGCAC
AATAGGCACTGCAACGCCCACAACGACAACATCCATGAGCAACACTGCCAATCCGACGAGGAGCTCATTGCACAGTATTG
AGGAGCTGGCCGCCAGTTCCTGTGCCCCGAGAGCAGCGTCTCCCAACAGCAACCACACTAGCAGTGCCAGCACCACTCCG
CAGCAGCAGCAGCAGCAGCAGCATCACATGCAAAGCGGCAACCACAGTGGCTCCAATCTCAGCAGCGACGATGAGTCCAT
GTCCGAGGATGAGTTCGGTCTGGAAATCGACGATAACGGAGGCTACCAGGACACCACCTCCTCACACTCGCAACAGAGCG
GAGGAGGCGGTGGCGGCGGCGGTGGCAACCTGCTAAACGGCAGCTCCGGCGGCAGCTCCGCCGGCGGTGGCTACATGCTG
CTCCCCCAGGCGGCCAGCTCCAGTGGCAATAATGGCAATCCGAATGCCGGCCACATGTCCTCCGGTTCCGTGGGCAATGG
CAGCGGAGGCGCTGGCAATGGCGGAGCGGGCGGCAACTCCGGTCCCGGCAATCCCATGGGCGGTACGAGCGCCACGCCGG
GACACGGCGGCGAGGTGATCGACTTCAAGCACCTGTTCGAGGAGCTTTGCCCCGTGTGTGGCGACAAGGTGAGCGGCTAC
CACTACGGCCTGCTCACCTGCGAGTCCTGCAAGGGATTCTTCAAGCGCACCGTGCAGAACAAGAAGGTCTACACCTGCGT
GGCGGAGCGGTCGTGCCACATCGACAAGACGCAGCGCAAGCGGTGTCCCTACTGCCGATTCCAGAAGTGCCTCGAGGTGG
GCATGAAGCTAGAGGCTGTTCGAGCGGATAGAATGCGTGGTGGACGCAACAAATTCGGACCCATGTACAAACGGGATCGC
GCGCGGAAGTTGCAAGTGATGCGGCAGCGGCAGTTGGCGCTGCAAGCGCTGCGCAACTCGATGGGTCCGGACATCAAGCC
AACGCCGATCTCGCCGGGCTACCAGCAAGCATATCCAAATATGAACATTAAGCAGGAAATTCAAATACCTCAGGTATCCT
CACTCACCCAATCTCCGGACTCGTCGCCCAGCCCCATAGCAATTGCGTTGGGACAGGTGAACGCGAGCACGGGCGGTGTT
ATAGCCACGCCCATGAACGCCGGCACTGGCGGCAGTGGGGGCGGTGGTCTGAACGGACCAAGTTCCGTGGGCAACGGCAA
TAGCAGCAACGGCAGCAGCAACGGCAACAACAACAGCAGCACGGGCAACGGAACGTCCGGAGGAGGAGGTGGCAATAATG
CGGGCGGCGGAGGAGGAGGAACCAATTCCAACGATGGCCTGCATCGCAACGGCGGCAATGGCAACAGCAGTTGCCACGAG
GCTGGAATAGGATCTCTGCAGAACACGGCCGACTCGAAATTGTGCTTCGATTCTGGCACACATCCATCGAGCACAGCCGA
CGCGCTAATCGAGCCATTAAGAGTCTCACCGATGATTCGTGAATTTGTGCAATCTATTGACGATCGGGAATGGCAGACGC
AACTGTTTGCCCTGCTGCAGAAGCAAACCTACAACCAGGTGGAAGTGGATCTCTTCGAGCTGATGTGCAAAGTGCTCGAC
CAGAATTTGTTCTCGCAAGTAGACTGGGCACGGAACACCGTCTTCTTCAAGGATCTGAAGGTCGACGACCAAATGAAGCT
GCTGCAGCATTCCTGGTCGGACATGCTTGTTCTGGATCACCTGCATCATCGAATCCATAACGGCCTGCCCGACGAGACGC
AACTGAACAATGGTCAGGTGTTCAATCTGATGAGTCTGGGTTTGTTGGGAGTGCCACAGCTGGGCGATTACTTCAACGAG
CTGCAGAACAAGCTGCAGGACCTGAAATTCGATATGGGCGACTATGTCTGCATGAAATTCCTAATCCTGTTGAATCCAAG
TGTACGGGGTATTGTCAACCGGAAGACCGTCTCCGAGGGACATGATAATGTGCAAGCCGCTTTGCTGGACTACACCCTCA
CCTGCTATCCGTCAGTGAATGACAAATTCAGAGGGCTAGTTAACATCTTACCGGAAATCCATGCCATGGCCGTTCGCGGC
GAGGATCACCTGTACACCAAGCACTGTGCCGGCAGTGCGCCCACCCAAACGCTGCTCATGGAGATGCTGCACGCCAAGCG
CAAGGGATAGAGGCCGGGAGAACGTGACACGGAATACTTAATCATTTATGAAATGTAAATAACAAGGCGGGAAGGCCCTC
GGGGCAACCGGGTCATGGAAGGCGAACGAAGGATACAGCAGAATTCCGTATTATGAATATGGGAATGCATCATCACTACT
ACCACCAACTATCACACCTATACACACACATGCACACATTTGTTGATTCAATGTTAATTATTATTACGTTTACGGTTAGG
TCTAGTTTACGTTTAACTAATTAATTAATTTGTCTTAAATTAATTCGTGTTTTATTTGTAGTCCCTGATAAAGCAATTTT
AAAACACTTGAACCTAAACGAGAATATGTAGTAGATGTATGGATTTAAATTTAAATACGGCAAGGAGAAACACACTTTTT
TAGGCATTACAAAACAAAAGAAGCATGAGAAATTTTATTTTTATATACCTATATGAATACGATACTTATGGATACAAATC
TATATATATTTTTATGTAAATTGGCGTACTTTTAGCGTCCTACATATTTTTTAATTAGAATTTGGTTATACTATAGTTTT
GAAATTAGTATCGTTCCCACTTGAAGATCGATTCTTGTATTTTTTTGCGCCAAGTGTCTTGCATAGTATTTGCGTCTAAT
CTAATGGCAACAAAAAAAATATTGGAAAATCCATACAAAGAAAATGAAAACAAAGCAAATTTAGGTGTTCATGGTATGAA
TGTATGTGTATATTATAATTGTAATTTCATCTAAGTGTAAGAAAACAATGCAAACAACTACCTACAACAAGATAATGAAG
AGCAAGAAATTATATAAATTAATAAAGGTCGTGTTAAAAACTATATAGAAAATATATACTTACATGTATATTTAAATTTA
GCAGCGAGTTTCAACTATTTGTAAATTTCAACCAAGATGTAATTGTTTCAATGTCAACAACAAACAAATTGTAAAGCTTA
TATTTAAAATACAAAATATATTTTGTGCAAGGAAAGCGATAAAATCC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0075087
3980
FBtr0304627
5910
FBtr0347045
6060
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0074853
1027
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0074854
803
FBpp0293169
803
FBpp0312453
853
Comments
Transcript terminates at site supported by polyadenylated cDNA.
External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG4059-RB
ftz-f1-RB
Secondary FlyBase IDs
    References (2)