General Information
Symbol
Dmel\lncRNA:CR32658-RC
Species
D. melanogaster
Annotation Symbol
CR32658-RC
FlyBase ID
FBtr0073628
Feature type
Associated gene
Evidence Rank
Length (nt)
813
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 4 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          GCTCGTCCGGAGCACATCTCATTTCGGAAAAATAAAAATGTGAAAAAAAACACAGAAAATTTTTAGTAAAATCAAAAAAA
          AGAAGTTTTGGTTTGCTTCGCTTCGCTTCGGTTTACTTGGGTACAAAAGTGAAATAAACTGGATAACTACACCTTATACA
          TACATACTAATAATACACAGAAAATCACACTGTCATGCAGTTCAAATATACACCAACTGAGTGCAGTTGGTAAGTTTTGG
          GTACTTACACACCTTCGCCAACTGACCTAGTGAATCCCGTTCACCATTCCCGGATGTTAATTGATTGCTTAGTCTAGGAA
          TCAATTGCATTAACAAGCCAGAAATATTCGCCATTGCTTTTTGTAACGACGTGGAAGCAATGGCAACGGTTGCCAAGCAA
          CCGCTTTACACAAAAAGACTGAGAAACGCACACTTGATGTTTGGCCAACGGGATTACTATGGTATCCGGCTTTTCAAAAC
          GATGGTACCGGTCCCATTGGACAAGAGGATCGCATCGTGGCGCTAATTAAAAAATGGGTTTTCGCTCCGCTTGCTAATAT
          ATTGCCGTTCCCCCATCATTCCCATCATCTTATCGCTTGGGCTTGGCTTCCTTCGGATTCAATTGGGTCAGCTCAAAATG
          CAAACTAACTGAAGATCGTTCCGCCAGGCCATCATTAGGATAGATATAGCGGAGCTCTCAATTCGATGGTACCAGTCCCC
          CGATGGACGAGTGGATTGCATCGGTTTGGCCGTTATTAGCATTTCGTTCGTTCGTTCGTGTCTAAATAAACGGGATTCAT
          TGAACGCAAATTA
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0073626
          823
          FBtr0073627
          810
          Comments
          External Crossreferences and Linkouts ( 2 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          RNAcentral - A comprehensive ncRNA sequence collection representing all ncRNA types from a broad range of organisms
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          CR32658-RC
          lncRNA:CR32658-RC
          Secondary FlyBase IDs
            References (0)