General Information
Symbol
Dmel\Amun-RC
Species
D. melanogaster
Annotation Symbol
CG2446-RC
FlyBase ID
FBtr0073617
Feature type
Associated gene
Evidence Rank
Length (nt)
3014
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 61 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TTCCCGTCACACGAGTTAGCAGCACATCGCACAGCTGCATCGCTCCGCTCCGATCCTTTTTAATTTTTTGTTGTGCCTTC
        GGTGGCGTGCTCATTTCGAGAACAGAGTAACCCCTTTTTATTTGTCAGTTGTCAACGGCGCCCCTGCAGGCAGAAAGCAG
        AAACTGAAACAGCAGAGGAAGAAGAAGAAGCAGCACAGCACGGGCACAGCACGAAGCACGCAGCACAGCACAAGCACAGA
        GGCGAAGCGAAGCAAAGCAAAGCAGAGGCAACACAGAAAAACAGCAAAGCATTGGAGTAGTTGTTTGGATGTGGACGGAA
        AGGAAGACTGGCGGCGACTAACTAAAAGGTATTTGTTGTTCACCCACTCATCTGTGTGCGTGCAGTGCGCTAGTGAAAAG
        CTGTTCTCACCGTTTGCCAAAAAGACAAGAGCAGTACGTTGACAGGAGCAGCTCGGAACGGACAGGAAAAGCAGGAGACT
        AAACAGTAAGCAATAAATTGATTTGGCGTATAGTAGCTTACACCAAAGTACATATATTGCCGCATATATAGCCAGCCGGT
        CACTTGCGGATCAGCCAACGTCCTGGGCCCCAAGGCGATAGATACCACGATAAGGAGATACAGCGATACCACCAATCATT
        AGCAGGCGACAACGACACATCCGCATCCGCAGAAGATGTCCAACGGCAAGGCGACGGTCTCGTTCTTCGAGACCGGGAGC
        ACCAAACAGTTCGAGTACTGCTACCAGCTCTATCCCCAGGTTCTTAAGCTAAAGGCCGAGAAGCGCTGCAAGAAGCCGCA
        AGAGCTGATCCGCCTGGATCAGTGGTATCAGAATGAACTGCCCAAATTGATTAAGGCACGCGGCAAGGACGCGCATATGG
        TATACGATGAGCTCGTCCAGTCGATGAAGTGGAAGCAGTCGCGCGGCAAATTCTATCCGCAGCTATCCTACCTGGTCAAG
        GTCAACACACCGCGCGCCGTCATCCAGGAGACAAAGAAGGCCTTCCGCAAGCTGCCCAATCTGGAGCAGGCGATCACAGC
        TTTATCGAACCTCAAGGGCGTTGGCACCACAATGGCCAGTGCACTGCTGGCAGCCGCAGCTCCCGATTCGGCACCATTCA
        TGGCCGACGAGTGCCTGATGGCCATACCAGAGATCGAGGGCATCGATTACACCACCAAGGAGTACCTCAACTTCGTCAAT
        CACATTCAGGCCACCGTGGAGCGCCTCAATGCGGAGGTGGGCGGGGATACGCCGCACTGGTCGCCTCATCGCGTGGAGCT
        GGCCCTCTGGTCACACTATGTGGCCAATGATCTCAGTCCCGAGATGCTCGACGATATGCCGCCGCCTGGATCCGGCGCCT
        CCACTGGCACCGGTTCACTCAGCACAAACGGCAACAGCAGCAAGGTGCTCGATGGCGACGATACCAACGATGGTGTGGGT
        GTTGATTTGGACGACGAAAGCCAAGGAGCAGGCGGTCGCAACACTGCTACAGAATCGGAGACAGAGAATGAGAACACCAA
        CCCGGCTGCTCTGACGCCTCTACAGTCGGGCGAGGCCAAGAACAACGCAGCTGCCGTTGGCGCCGCCCTGCAGGACGGTG
        ACTCCAACTTTGTTTCGAACGATTCCACCTCCCAGGAGCCGATCATCGATGACAACGATGGCACCACACAGACAACGGCC
        ACCACTTCCACAGAGGACGGTGAGCCCATCGCCCTAGACATTGGCATTGGCATCGGTTCGAGTGGAACACCGCTCGCCTC
        GGACTCTGAAAGCAATCAGGAGGCGCCGCCCAAGACCAACAGCCTGCCCATCCTGACTCCCACACAGCACTCGAGCCAGA
        ATCAGAATCAAAAGCAGTCGCCGAGCCAGCCCCACAAAACTAACAATTCGATCACCAACAACGGTCAGCCTGCTCCTTTG
        GCAGAAGAGGAAGCGGTTACAGCAGCACCACAGCCAGCCAGCAAAGCGACTGCAGCACCAGCCAATGGAAATGGTAACGG
        GAACGGCGTCCTGGGCGACGAGGATGAGGATGAGGCGGAGGACGAGGAGGAAGATGAGCTGGACGAGGAGGAGGATAATG
        AGGCGGAGCTAGAGGCTGACGAGAGCAATAGCAGCAACGGCATTGTGAGGGACAGTAAACTGCAGCAGCTGGCGGCGAAC
        AAGGCGGTGGATGCGGTTTCACCGGTAGCAGCGGGTGCAGACTCGGCACCAGCCATTGGACAGAAGCGTACTGCCCTGCA
        CTGCGATATGGAGCTGAAGAACGCCGGCGGAGTGGGTGTGGGCGTGGGGGAGAAGTCACCGGATCTAAAGAAACTGCGCA
        GCGAATGAGGCGGAGGTGAGGAAACGAAATACGGATACGGATGCGGATGCGGGTCAGAAACGGGGATCGGTTCGGCTCGG
        CACGTTTCGGTTCGCCGCGTATCCGGTGGAAAGACATATGTATGTAGTGCAGTTGAGTCGACATAGAGACATAGAGCAAC
        ATTACCTACACTTTACCACAACAACATTCAAGAAATTCTACTATTAAGCAACTAACTATACATACATATAATATATTATA
        TATATATATATATACACATATATATATATATATATACAACATATAACGAGATGCGAACACCCAACACACTCCACTCTCAT
        ACACACAACACAGACACACACAACCCGACATAACATGAACATAACCGATCAGATCAGAGCGGAATATAGGATCCCGATCC
        AGAAGGCAGTAAGCAGCACCACAAACAACATTTCAATAGCATAGAAAGCGCGCCAAGATGAAGAATCAGAAGAATCCGAT
        CAAGAATCCGAAGAACAAGCAGCAGAATCAGCAGCAACAGAGAGTTCAGAATGCAGCGTTAACGTAATTTAACTAAAACG
        AAAAGCAAATGCATACATGAATAGTAACTACAAAACAAGATCAGATGGAAATCGATATTTTTACACAGTCAAAAGGAACA
        TTTAAATATAAAGAAATTTACAAATGCCGCAGTTGCCCACTACATACAAAAAAC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0073619
        3411
        FBtr0073615
        3694
        FBtr0073616
        3053
        FBtr0073618
        2948
        FBtr0303336
        2704
        FBtr0303337
        2945
        FBtr0303338
        2784
        FBtr0303339
        2986
        FBtr0333796
        2658
        FBtr0333797
        3028
        FBtr0345164
        2622
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0073454
        550
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0073456
        550
        FBpp0073452
        550
        FBpp0073453
        550
        FBpp0073455
        550
        FBpp0292399
        550
        FBpp0292400
        550
        FBpp0292401
        550
        FBpp0292402
        550
        FBpp0305930
        550
        FBpp0305931
        550
        FBpp0311374
        550
        Comments
        Transcript terminates at site supported by polyadenylated cDNA.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        Amun-RC
        CG2446-RC
        Secondary FlyBase IDs
          References (2)