General Information
Symbol
Dmel\Evi5-RA
Species
D. melanogaster
Annotation Symbol
CG11727-RA
FlyBase ID
FBtr0073547
Feature type
Associated gene
Evidence Rank
Length (nt)
5936
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 49 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      GCCAGTGGGCGAAAAAAAACATTCGTGAATTCACCGTCGTCGAACGAACGCTGTATTTTTTTCCAGTGCAATATTCGGTC
      GATGTATAACGAGTGATTGAATTAAAGTAGTCCTTTTAAAAAAAGTACTAGTATTTAAATAAAAATAAAGTCATACAGAA
      CAGCATAGGGAGAGAGGGCGAGAGAAAAAATTGCTGCTGCTGAGGTGTGTGCAATTGCCTGTGCGTGTGTGTGTGTGTGT
      GTTTGTGTGACGTTTACAGCAGCAAAAAGTTCGGTAGTGTCGTCAAAATAATCGTGTATTATAAAGTTAATGCAAACGAT
      TCTCGATCGGATACGAGTTGATCGCGACATATTGAGTTCGTCGAATGTGGAAAAGTCTAGCTGATTGAAAACGAAACGCG
      GATAAAAAAAAAACGATAAACAACGGCAATTTGTTGCTGCCGCAACAGCAACAACAACAGCAGCAGCGCACTAACGCAAC
      CACCACCACCCCCTGTTCCAGCCTAACGGTTCATTTACAGTGGCCGAAGAAGCAGCAGCAAAGTATGCGAAACTAGGAGC
      ACCATGTGGCGGTTTTAGAGAAGCAGCAAAGTATTATTAACCACGATTCGGGATTAGGATCAGGATCAGGATCAGGAGCA
      CTACAGATTGAAGCAATCGAATTCGAGGAAAACGGTAGTCCAGGGACGCAAGATTCGGAAAGAGGGGAGTATAGACTGAG
      ATCAAAGATCGGAGAACGTCGTTCTGTGTCAGAAGATGACCCTGACCACAACGACCACTGCCTCATCAGCCGAGAGCCAA
      GCGAAAATGGACGTAAAGGGCGGCGCACTTCCCGGCGAAGAGAACCTGCCCACATCCGAAATGGATCTGCTGGCCAAACT
      GGAGGCGGCCAATAAGCTCATCGAGAGCGATGCCAAGTCCCTCAACTCTCTGCATTCCACGCACAGTCGCAAGAACTCGG
      ATACGAGTCAAATCAGTCTTACGTCGAGTGGAAATTCGGTGGCCGAAGAGGACATCTGGACGACGTGGGCCACCATCCTC
      AATGACTGGGAGGGAGCACTGAAACGAAAGAATCCCTGCGTCAGTGAGCTGGTGCGCCGTGGAATTCCACACCACTTCCG
      AGCGATCGTATGGCAGCAGCTAAGTGGAGCGTCCGACGGCGACAAAAAACAGTATGCGGAGTACATCAAGGCGACCAGTG
      CCTGCGAGAAGGTCATACGGCGTGACATTGCCCGCACCTATCCCGAGGTGGAGTTCTTCAAGGAGAAGGATGGACCCGGA
      CAGGAGGCCCTGTTCAATGTGATCAAGGCATATTCTCTGCACGATCGCGAGGTCGGCTACTGCCAGGGCTCGGGATTCAT
      TGTGGGCCTGCTGCTGATGCAAATGCCCGAGGAGGAGGCATTCGCTGTGCTCGTGCAGATCATGCAGCAGCATCGGATGC
      GGCACATGTTTAAGCCCTCCATGTCGGAGTTGGGCTTGTGCATGTACCAGCTGGAGAATCTGGTGCAGGAGCAAATACCC
      GACATGCACATTCACTTCCAGCAGCAGGGCTTCCAGACGACCATGTACGCCTCCAGTTGGTTCCTCACCCTATACACGAC
      CACTCTGAATGTCAATCTAAGTTGTCGCATCATGGACGTCTTCCTCAGCGAGGGCATGGAGTTCATCTTTAAGGTGGCCT
      TGGCCCTGCTGCTCACCGGCAAGGATACGTTGCTCTGCCTGGACATGGAGGCCATGCTTAAGTTCTTCCAAAAGGAGCTG
      CCCGGTCGCGTGGAGGCGGATGTCGAGGGCTTCTTCAATCTAGCCTACTCCATAAAGCTGAATACTAAGCGTATGAAGAA
      GATGGAAAAGGAGTACCAGGACCTCAAGAAGAAGGAGCAGGAGGAGATGGCCGAGCTGCGGCGACTGAGACGCGAGAACT
      GCCTGCTGAAGCAGCGCAACGAGCTGCTGGAGGCCGAGAGTGCCGAACTGGCCGATCGCCTGGTCCGTGGTCAGGTCTCC
      CGAGCTGAGGAGGAGGAAACTAGCTATGCCATTCAGACGGAGCTAATGCAGCTGCGCCGATCATACTTGGAGGTCTCGCA
      TCAGCTGGAAAACGCCAACGAGGAGGTGCGCGGCCTGAGTCTACGGCTGCAGGAGAATAACGTATCCATCGACAGCAATA
      ACTCCCGGCAATCGTCCATTGACGAGCTCTGCATGAAGGAGGAGGCGCTGAAGCAGCGCGACGAGATGGTCTCCTGTTTG
      CTGGAGGAACTGGTGAAGGTGCGTCAGGGACTGGCCGAAAGCGAGGATCAGATCAGGAACCTCAAGGCCAAGGTCGAGGA
      GCTGGAGGAGGATAAGAAGACGCTGCGGGAAACGACGCCAGACAATTCGGTGGCTCATCTGCAGGATGAACTGATTGCTA
      GTAAACTTCGCGAGGCTGAGGCCTCACTTTCGCTAAAGGATCTCAAGCAGAGGGTGCAGGAGCTGAGCAGCCAGTGGCAG
      CGTCAATTGGCCGAGAATCAGCGCAGCGAAAGCGAACGCACCACCAACGCTGTGGACTCTACGCCCAAAAAGCTGTTGAC
      CAACTTCTTTGACAGCTCCAAGAGTAGCGAGCACACGCAGAAGCTCGAGGAGGAGCTGATGACCACGCGCATACGCGAGA
      TGGAGACGCTTACCGAGCTCAAGGAGCTGCGACTTAAGGTCATGGAGCTGGAGACGCAGGTCCAGGTGTCCACCAATCAG
      CTGAGGCGGCAGGACGAGGAGCACAAGAAGCTCAAGGAGGAGCTCGAAATGGCCGTGACCCGGGAGAAGGACATGTCCAA
      CAAGGCGCGTGAACAGCAACACAGATACTCGGATCTGGAATCTCGCATGAAGGATGAGCTGATGAATGTGAAAATCAAAT
      TCACCGAGCAAAGCCAAACGGTGGCTGAACTGAAACAGGAAATTTCCCGTCTTGAGACCAAGAACTCGGAAATGCTCGCC
      GAGGGCGAACTGCGCGCGAATCTGGATGATTCGGACAAGGTGCGCGACCTGCAGGACAGGCTGGCCGACATGAAGGCGGA
      GCTGACGGCATTGAAAAGTCGTGGCAAATTTCCGGGCGCCAAACTGCGCAGCTCCTCGATCCAATCGATCGAATCGACCG
      AGATCGACTTCAATGATCTGAATATGGTGAGGCGCGGAAGTACGGAGCTCTCCACATAACCTACAGATGGATCAGATCTA
      GCATATCCAAACCAACCAACAGCCACAACCAGTAGAAAAGCAGCGAGTGAGAGGAAAGTACAGGATACACCCAAATCTAA
      ATGGGTGGGCAAGCTGGAGGCGATTTATATATATTAATATATATATACATAGATGGATATACATATATATGAGGGGCCTG
      TGATTATGAAACGGAAAGGGAAGGTGGAGCATCGAGTGGAGGGAGAAGTAGAAGGAAGAGGGCAGAATAGTTGCAATCCC
      ATTACAATATTAGTTATGTATAATATTCGTTAAAATTTTACTACTACTATTACGATATATGGATATTTTAGTACGATAAT
      TATAAACTATATTTTTTTTTTTGCAATAATTTTATTACTGTTATGTTTTGCAATCGAAACACACTCATATTTATTTATTT
      TAAATCCTAATTGAAACGATATTGTGAGAGTATTTTACACCCCTGTACATTAATCAATACGGCAACTAATCCGATTCGAT
      GCGATGCGATGGATTGGAGTTAGGAGATTGGCATTTTGATATACCCTAGATGTATGGCACATATGCAATGCAATGAATTT
      TATGTAAACCCCTGAGGAAAAAACAAAACCATTTCCCAACCCAGGCATCCTGTGAACCACTTTTAATGTAAGTTTTAAGC
      GAATCCGAAATTGTTCTTGGCTACAAACAAAACAAAAAAAAAAAAAAAAACGATTTTAATCAGCACGCACACCTTTTTAA
      AGTGTGCGGATAATGCTTGGTTTATCCACTTGATTTGTATTATGATTTCATCCCTGTAGAATGATATTAACACTCACAAA
      CACACAGTTGTCTGGAATGAATTTTGTAACTCTCGTATAGTAAGCTAAACCAATCTAAATCTAAAACGATAACTAAAATA
      AAACCAAGTGCGAAAGACAAAGTAACATGCGTGGCCAAATGCAAGATGAGAAACTGAGAAACCAATATATAACTATTAAA
      AATAGTTTAAAACGATATGTGAAAGAACCACGAGAAAAGGGGCCCACAATTTATCCCCGTTTAAGAACGATATTACGATA
      ACGACTACGATATTCACACTACTTACGATATTCTACTTAGTTAACAGTAGCGCTTATCTTTATCCACAAAAACAAAGAAA
      ATACAATTATATGATTTATATGGTTCATTTAACCCATATTTGGCAGCTTGTCGCGTAAAACGATTTCGATTTTGACATCG
      ACTTTCGAAACGATTAACAATAATTATCCACAAACATTACAATTATTCAGGTTGAACCATGTTTTCCATGTGCAATATTA
      TACATTTACTTTCGCTTCTATTGCGTTTCGTATTCTATGACAATTTTTTATTATCATTTGTTAGTATGACGTCCTCAGTG
      CTTAGGTTTGTTACTTATCGCAACTAAGACCGATTAACTTAATTAACTTAATTTTTGTAATTCCATTGATTTGCCCATCA
      TGACAAACCGATTAAAAAACAGCAAGAGAAATAAGAGAGATCTATGTAATAGGATTCGTAGCTTGTAAGAATGTCGAAAA
      TGATGTCACAAAACTTTGTTATGTAAACACTAAGTATATATGTAATGCTTAAGTTTTGTTCTCGACTTTGGCAGAACTAT
      TAGAATTTTTTGTTCTACGCGATAATTAATGATTATGATTATGTAATGTATGTGTTATATATAACATATAAAATGATATG
      TTTGCGGCTAAAAGAGGAGGCTGCTGGGGGAGGGGCAGTATTAACAATCAGCAGGAGTTAACAGACATTTAAATATAGCA
      AACATTCCCGAGAACGTCAAATTTCCCCCAAGAAATGAAAAGATAAGCAAATTCCCCCAACAGCCTCGAGTCTTAAAAAA
      TTGGCAAGTCTAGAGTTAATTGCGTATTATGTTATGGCAAGCGAAGGCACAAATTATACGATATCTAAAATAGTTTATAC
      AAATTTATACACGCAAATGGAGAGCATCATTGTTGGCCAAAGTCTAGACTTGGCCCGCGCATAGTTCGGTGTTAACTGAT
      TGACCAATAAGTGTGGAACTCGTGCGAATTGCCGTTCAAACAACTGGCCCCCAGCCCCACTTAAGTGACTCACCGGGGCG
      GTAGTATAATGAACCCCATCGTCGATAGCAGCTAATTTCAATGCCCTGCCCTGTCAGTTCGATTTGATAAATGTGAAAAT
      GTGAAAAGAAAGACTCTTGGCGTTTATCAATTCAGCATGTGAATGCGAATGCCAACGACTTTGGGCCCAGACAGAAGGCA
      GACGGTAACGATTTGTTGACCTTGGACGGCGAGAACGATCGAAACTCCTTTGAACGCAATTAATTAGCGGGCAAACTCGC
      TCATAGCGTATACTTAATACAAATAAATCAAGTTCAGCTTCCATTGAGCAAGACTCTACAGTCAACAGTCTAATAGTCTT
      CAGTGTTTAATGTGTTCTGTGTTCATCTTGATTTGCACTTATTGATTGCGTTTCTCGTTTCATTCATTGTTGATCCATTG
      AACAAAGCCAGGCGACAAAATTAAAAAAAAAAAAAGTCACAAGAACTAGAAAGTAGTTGACAAAATACCACAACAAATAG
      TGTTATATACTTTACATATACCTAACTATATCAATATAACGATAAAACTGATAACTGAAGAGCAGAAAGAAGTAAAATTC
      AACTAAAACTACAACAAATCAATAAAATTAAACGGATATACAAAACGAAATCAAAGTTACAATTTTTAGTATTAAATAAA
      TGAAAAGAAAACCAAC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0073546
      3177
      FBtr0300732
      3159
      FBtr0300733
      5156
      FBtr0332620
      5423
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0073392
      807
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0073391
      779
      FBpp0289956
      773
      FBpp0289957
      801
      FBpp0304866
      773
      Comments
      Micro-exon sequence based on FBrf0161031 (Volfovsky et al.)
      Transcript terminates at site supported by polyadenylated cDNA.
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG11727-RA
      Evi5-RA
      Secondary FlyBase IDs
        References (2)