General Information
Symbol
Dmel\Fit1-RA
Species
D. melanogaster
Annotation Symbol
CG14991-RA
FlyBase ID
FBtr0073209
Feature type
Associated gene
Evidence Rank
Length (nt)
3119
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 122 )
Sequence
CGCAGACAAACGGTCATACTGCTCTGCTGCTGGTTTATTTATAAATTAATTTCTCTCTATCTCGGCTCGTTCGCTTTGTC
TCGTCGCCCGCGACGTGTTGTTTTGTGAAAATTTGCATCGCATTTTTGAGCGCGTGCATTAGTGTTCGTCGGTGTGTTGA
TGTGCGAGGAAAAGAGCGAGGAAAACGCTGCGAATTGCGATTGCTAGAGAGATCGGGAAAACAAAACATCCCAAGCAGCA
GCAAGCAAGCCATCAAAATCGTAACCTTGGGCGTGTGTTAATCAAGTGATCCGTACATCCCCGCCTCTCCCCCCCTTTTA
TCATCATACATACCACCACCATCTCTACATCCAACGATTTTGATCTGGATTACTCGGCTTGTTGGATTGTTGGGTCTGTT
TCGCTGGCGTTTCTGTTTCCGTGCAAACATCTGGCGAGATAAGGGCCTATATAGTTTCGCCACCGCCACAGTCGCAGTCC
CCCCCTCTCCGCTCCCCGCCAGCCAACGACAACGACAAGAACAACAAAAACTTGGTTGCAAAAACGGTGCTGAACGTAAG
TTGAATTACGTCATCGTTTCGAGGGCAAATTTAGACTCTGATTGTGCCATATATATACACTATACAAATATACCCGCAGT
TATAGTTTCGCCTTTGGACAGAAGAGACGCCCGCGCATCGGAACTTTTAGCGAAAGATGATTCATGTGGGCGAAAATACG
TGGAACCTGCGGATCCTCATCACGGATCTGCAGGTGGAGAAGACGCTGCGCGTGAAGGGTGACCAGCACATTGGCGGCGT
AATGCTGAACCTGGTGGATCCGGAGTTGCCCAAGGATTGGTCCGATCACGCCCTGTGGTGGCCCGCCAAGAATATCTGGC
TGACCAGGACGCGGTCCACTTTGGACCAGGCCGGAGTTCAATCGGATTCCTTTCTGCACTTCACGCCCATGCACAAGACA
CTGAGGGTGCAGATGCCCGATCTTCGTTATCTGGACTACCGCGTCAACTTTTCGGCCAAAACTTTCGGAGCCGTTGTGAG
CTTGTGCAAGGACCTGGACATTCGCTATCCGGAGGAACTGTCTTTCTGCAAGCCCCTGGAACCGGAGCATCTGAAGAAGA
ACTTCTCCAAGCTGCCGCAGCGAAAGATTCCGGTGGCGGAGGCAAATGGAATCGCATACGTGCAGCCAGCGCTGGACACC
AACTCCTTTGTCCCGATCACAGGAGCCTATAACGGTAGCAATGGCAGCCTGGATCGCTCGCACAATGGCAATCTGCTGTG
CGCTCCGGCTTCACCGTATACCCGACGGGCAGCCACTGCTCCGGGAACACCCATCAGCTCGCCCACGGGCACCTGGAAGC
ACAACTCCACTGGCTATGCTAGCTACGATTCCAACTCTAGTTTCGGAGACCTCCAGGAGAATCTGGCCATGTCGCCAAGG
TCGCCCAGTCCGGATGTACGAGCACGCTTGGTTCGACCCAAGTCCCGGGTGGAGAAAGCCCGTCTCAACGTGGGATGGTT
GGACTCGTCCCTTTCCATCATGGAGCAGGGAGTTAGGGAGTATGACACTCTGTGCCTGCGCTTCAAATACTTCACGTTCT
TCGATCTGAACCCCAAGTACGACCAAGTGAGGATCAATCAACTGTACGAGCAAGCCAAATGGAGCATTTTGAACGAGGAA
TTGGAACCCACCGAGGAGGAGACCCTCATGTTTGCCGCCCTGCAGTTCCAGGTGAATCATCAGACGGATCTGCATCCCCC
AGGCATCGATTCCGGAATAGATACCTCCAGTCAGGAGACTGGCGGCGAGGACGACATTGACTCCGCTCTCAACGAGCTGC
AGATCACACTCGAAGGACCAGGAGGTGGCAAGGATCAGGGCAACATCACCAGGATACCAGAGCTGTCGGACTATTTGAAA
TTCCTCAAGCCTCAAAGGTTCACCCTTAAAGGATACAAGCGCTACTTCTTCACCTACAGGGATCTGCATCTGCACCTTTA
CAAATCGCAGGATGAGTCCAGGCGGGGAGCTCCCACCATCAGCATCAATTTGAAGGGCTGCGAGGTGACGCCCGATGTTA
ACCTGGCCCAAGGAAAGTTCGCCATCCGTCTGGAAGTTCCGTCAGAGATCAGAAATGGTCCGAACAGTGAGGTCTGGGTG
AGATGCGACAACGAAGAGCAGTACGCCAAGTGGATGGCAGCCTGTCGTCTGGCCGCCAAGGGTCGCTCTCTAGCCGATAG
CTCTTACGACAGCGAAGTTAGCAGTATTCGCTCGCTGCTGCAGATGCAGAAACCCGCCCAGGGAGCTCCGCTCACCGTCA
ACCCGCGAAGTGTTGAGCCCATGGATTACCTATCGCCCAAAATGATGCGCAAACTATCCAGCAAGGCGGTGCAGAGGATC
CTAGAGGCCCATGCCAACGTTCGCCAGCTGAGCTTAATGGACGCCAAGATGAAGTACATCCAGGCTTGGCAATCTCTACC
AGACTTCGGTGTTACTCTCTTCATCATCAAGTTCGATGGACACAAGAAGGAGGAGCTGTTGGGCGTGGCCAACAATCGTA
TCATGCGCATGGACCTCAACACCGGCGATCACATAAAGACCTGGCGCTACAACACAATGAAGGCCTGGAATGTTAACTGG
GGCATCAAGTGCATGATGATTCAGCTGCAGGACGAGAACATCGTCTTCTCCGTGCAGTCGGCCGACTGTAAGGTGGTGCA
CGAGTTCATCGGCGGCTACATATTCATGTCCATGCGATCCAAGGAGAACAACCAGACGCTGAACGAGGAGATGTTCCACA
AGCTGACGGGCGGCTGGTCGTAAACGGATTGGCGCAGTCTGGAGCATTGGACTGGAGTCTTGAGTGCCAAGCACAAACCT
CGTCGCATGTTCTACAGTTTTATCTACATATATTTACCTAATGTAGGGTGCGTTGATTTATGGGTTGACTGGTAATCTGT
GGACCACACCAAGCAACTTCTTCGTAACTCTAGTTGTTAGTTTCTCAATGTTTTTTTTCTGTTCGGTTTATCAACCTAAA
TACGTATATATTTTGTAAACAACTTTGACGGACTAGTGTCCGACACCAGAAGTTGGTTTTCTTTTGTCGGCATTTACCT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0073210
3469
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0073065
708
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0073066
708
Comments
Transcript terminates at site supported by polyadenylated cDNA.
External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG14991-RA
Secondary FlyBase IDs
    References (2)