General Information
Symbol
Dmel\Awh-RA
Species
D. melanogaster
Annotation Symbol
CG1072-RA
FlyBase ID
FBtr0073155
Feature type
Associated gene
Evidence Rank
Length (nt)
2039
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 54 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CCGGCAGTTAACGCAGTGGCCTCGAAGCTGTAACAACATCTCGCGTCCGCTCGATCCGCTCGATCCGCTCCGCTCCGTCA
          CGAGAAAAGCGAGAAGCGCTCAGAGTATCTGCAGTGAAACGTGTTATCGTGATAAGGTTCTACGAGTATTCCATGCCATA
          AGGTGTCGCACATTATATTATTGAAATCGAAACGCAACATTCGCCGTCGGCTAAGAAAGTGAACTGTTATCGAATGTGCT
          AATCAAAAACAAAAAAAATGTTGCAAGCGCCTGCAAATTGATTTCTATCTCGGATATGCGAATTTACACTGGTTATTAAT
          AGATCTGGTTTAAGAATACGATTATATAAGCATCCTATGCAGACGGCGGCTTCCGTGGGACGCTTGACAAACTGATCAAG
          TCGTCGTCTTTATCATCTATATCTCCTCATACTGGCTGCGATCGGGCTCGATATCGATTCCCAGGCTAAAGCTGGCGACA
          GATTTTCGAGCAAGATACTTGGATTAACAACCGCCAAAATTGTGGAGGCAATTAAAATGAAGACTGAGCTGCGTTCCTGC
          GCAGCGTGCGGGGAACCCATCTCGGATCGGTTCTTCCTGGAGGTCGGCGGCTGCTCCTGGCACGCCCACTGCCTCCGCTG
          CTGCATGTGCATGTGCCCCCTGGATCGCCAGCAGTCCTGCTTCATCCGGGAGAGGCAGGTGTACTGCAAGGCCGACTACA
          GCAAAAATTTCGGCGCCAAGTGCTCCAAGTGCTGTCGCGGCATCTCCGCCTCGGATTGGGTGCGTCGGGCACGGGAGCTG
          GTCTTCCATCTAGCCTGCTTTGCCTGCGACCAGTGTGGACGCCAGTTGTCCACCGGCGAGCAGTTCGCCCTCATGGATGA
          CCGGGTGCTCTGCAAGGCTCATTATCTGGAGACGGTCGAGGGTGGCACCACATCGAGCGACGAGGGCTGTGATGGCGATG
          GTTATCACAAGAGCAAGACGAAACGGGTGCGCACCACCTTCACCGAGGAGCAGTTGCAAGTGCTGCAGGCCAACTTCCAG
          ATTGACAGTAATCCGGATGGCCAGGATCTGGAGCGGATCGCCTCGGTGACCGGTCTCAGCAAGCGTGTGACGCAAGTATG
          GTTCCAGAACTCGCGGGCGCGTCAGAAAAAACACATACATGCTGGTAAGAATAAAAAATAACGCACAGAACCCAATGCAT
          TTGAATGGCTCTAAAGCGGGTCTATACCCGACTCATGAATCCTCTATGGATGAATTGTCGCAGGACTCCAGTGTACACTG
          TATGCCCAGCGAGGTGTGACTGGAGCAATCCTCGCCAGCTCGAGCACATCGCTAGATGGCTGGACACCCACAAAACGTCC
          TTTCCTAGTCAAAATTTATGTAATGCGTCTACACGAAAGCAGTTTCGATTCGATCCGGAGAAAAATTGAAAAATAATGAA
          TCCTTCAACATCATACAAAGCAGTCCCGGTTTTTAGGCTTTGAGCAACCCGAACGAACCACCCAACGTCAACACAGTGAA
          ATCTCATCATAAAAGACACAGCAAACAAACAAACAAACAAACATTCCTGCATTGTAGTCTAAGAAACTGCAGCTTAGTTA
          ATTTAATTTAAATGAAATTTAAATTTAATTTAGTTTAATGTTCAGTAACCGATAAGTGTTTCCCACATCATTCAACTCGA
          AGATTGATAACTGCTTGCCAAGGCTCCTGTAATATATTTATGCGTATGCCTAACCAATCATTGTCGTATATTTACCATGA
          GAAACGTTGTTATTGTTTATTTTCTTGTTTTCTAAATGTATAAAAATTGATTTAAATATATAAATATATATATATAAACT
          TAGTTCTATAGTCGTACCCTAAATATAACTCGCCAGGCAATTTGTATATAGTAATGATAGCCGAAATTGATAAGCAACGC
          AGAAAACACAGCTAAAAACTAACATTTAGTTAACAAAAATTATAAAATACAATTAAAGATGAACCGAAATCAATTAAAAA
          AGAAAAGCAAATTAAAGAGAAAACAACTTTTTCAAAAAC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0073156
          2104
          FBtr0330070
          2104
          FBtr0330071
          2092
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0073013
          214
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0073014
          275
          FBpp0303103
          287
          FBpp0303104
          271
          Comments
          Transcript terminates at site supported by polyadenylated cDNA.
          Based on cDNA(s) that contain premature stop codon and/or downstream start; may or may not produce functional polypeptide.
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          CG1072-RA
          Secondary FlyBase IDs
            References (2)