General Information
Symbol
Dmel\ZnT63C-RC
Species
D. melanogaster
Annotation Symbol
CG17723-RC
FlyBase ID
FBtr0073056
Feature type
Associated gene
Evidence Rank
Length (nt)
2202
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 31 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CGATGACTGTGGCTGCAGTCACACTGAGTCGGGAAAATAATTATTTATTAAAAATTCGTGGACCCGCGCTGTACATCTGT
        GTCTGTGCTGTTCGCTCCGCTCCAAGTGCGGCAAAAAGCAACCAAGAAGGCAGGCAGCCCAATCGGTAATTTACGGCGGA
        GTAGTGAGGCGATATACGGAAATCGCGACCAGTGCACGTGCAATTGTGAATCGTTCTCGATTTTCCCGACCCGCACCCTT
        TCTTCTCTTTCGACCATTGTGACTGTGCACAATTAACTTGCATACATACGTGTATGTATGTACACACTCTGTTTCCTCTT
        CAATTGGAGCTTAGGAACCTTAACAACCAAAGAACCGATTTCCAGACTTAAAGCTAAGTTTCTCCAAAATGGCCAAGTAC
        TCGGGCAAAAAATGCCGGCTGCTCTCGATGATGTGGCTTACGGCGTTCTTCTTCTTCGTGGAGATCATAGTGGGCTATGT
        GACCAATTCGATGGCTCTGGTGGCGGATAGTTTCCACATGCTGGGCGACATTGCGGCCCTGGTCATATCATTCCTGTCTG
        TGAAGATGTCACCGAAAAAGTGGTCAAAGAACACTTTTGGCTGGGCCAGGGCAGAAGTCTTGGGTGCTTTGGTCAACGCC
        GTTTTCCTGGTGGCCTTGTGCTTCAGCATCACCATCGAGGCTTGCAAAAGATTCATTGAGGAGGAGCCGATTCACGAGCC
        TGAACTGCTTGTCATCGTGGGAGCCTTGGGTCTTCTGGTGAATGTTATTGGACTTTGTCTGCTTTACGAGCACGGCGGTC
        ACCATGGACACTCACATGGCGGCGGACTCACCCGTAACCACAGCCGCCTCACTGAGTTGGCCAACATGGACGAGGGCGAG
        GATGAGCAAAACGACTTTGCCTACGAGAAGCAGAAGGAAAAGGCACCGGTCAAGAAATCCAGCCATGGACACAGCCATGA
        TCCCGGCCAGATGAATATGCGCGGCGCCTTCTTGCACGTTTTGAGCGATGCCCTTGGCAGCATCATTGTCGTAATCAGTG
        CTGTGGTGGTGTGGAAGACGGAGTGGAAGTACCGGTACTACATGGATCCCGCTCTGTCCATCGTTTTGGTTGTTTTGATC
        CTGCACTCCGTGTGGCCGCTGCTGCGCGAGTCCGCTTTAATTCTGCTCCAAACGGTGCCCACCCACATCCAGGTGGATGC
        CATTCAGAAGAGGCTTCTGGAGAAAGTTGATGGCGTGCTGGCTGTGCACGAGTTCCATGTGTGGCAACTGGCCGGCGACC
        GCATCATCGCCTCTGCCCATATTAGGTGCCGTAACCTTTCGGAGTACATGAAGATTGCCGAAAAGGTGAAGGAGTTCTTC
        CACAACGAGGGTATCCACTCTACCACCATTCAGCCAGAGTTCAGCGAGATCGAAGGCTGCAACATGTCCGATGGCACCTC
        CAGCATCAACATCAGCGGCTCCGACTGCTGCGCGTTGGATTGTCCTACCACGGAAGAAGGATGTGTCAAGGCCACGTGCT
        GCCAAAACAACAACAAATTGAACCAACTGCCCTCACCCACCAACTCGCCGTATCTGTGCCGCCAGCGGAATGCCGCCCGA
        CAGGCCGGCGATGTGGAGGCGGGTTCCCTGCTGGAGGCCACGTCCAGTGGCAACCAGGGAGCCACTGGTGGGGCCAGCAC
        AGGAGCGCCCGTGGCTGCGATAGGGGCCACGTCAACGCCGAAGAGCGATTTGGTTTGACGACAGCCACATCAGGCGCAAC
        AACATGTACACTTTGCCACGACCAAAACGGAAACCGCAACCGCAACAACAAAGGCCGCCACAACAGCAGCAGCAACATCA
        ATACGTGATATAATGTACGAGCCACGCGCCAACAACCTAGTGGTCTCCAGCGCACAGGTGGACGTCAATCTCGGCCTGAC
        GGTGACCGCCCAGCGGCGACGGGAGCTTCAGTTGCAGGCCGAACAGCAGTATCAGGAGCAGGTGTCACCACTGAGTACCA
        GGAATGGCGACGAGGTGGCACTCTAATTAGGAGCCTAGTTTAACGTTAATTGTGCAAACCGCTGCAATGGAGACTGGTCT
        GCCATGGTGCAGCTTTCGTGTTTTTTTGTATCATTATTTGTTCTTAGTGGAATTTAGGCGTAAATGAGAGTGGGACAAGT
        TCGGTCGATTGACCATTGAGCTAGTTTAATTAAAGTGAAATC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0073054
        1969
        FBtr0073055
        2566
        FBtr0073057
        2454
        FBtr0073058
        1955
        FBtr0330103
        2033
        FBtr0330104
        1959
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0072920
        449
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0072918
        449
        FBpp0072919
        449
        FBpp0072921
        449
        FBpp0072922
        449
        FBpp0303136
        545
        FBpp0303137
        449
        Comments
        Transcript terminates at site supported by polyadenylated cDNA.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        ZnT63C-RC
        Secondary FlyBase IDs
          References (0)