General Information
Symbol
Dmel\CG13921-RB
Species
D. melanogaster
Annotation Symbol
CG13921-RB
FlyBase ID
FBtr0072773
Feature type
Associated gene
Evidence Rank
Length (nt)
4273
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 27 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TCTCAGTTGCGTTTGAGCTGCGAGCGTGGTTTGTCGCTTGTCGTGATCTCCGCTCTCTGCCCATTCGAGAATCCGCTGCA
        GGTTCGATTCCGCGACGACGTCTTTGTGTTCGGAGTGTGTGACCGCGGTGCCTTGTTTATGTTAATCCGATATTTATATG
        TATATACTGGCAAAATAGTGCAGAAGTGGCAATAAATTCGGCCAATTAATCGGAGCTCGGTTTTAGAAGCGTGAGACCCG
        CGAGCTGAAGGCAGTGGAAAAATGAGTGTGCAGCATAAGTGATCGCTGGAAGTGGAAGCTAAAGGGTCAAACCGGTTTTC
        GGACAACATGGAGTTGCCACCAGCAGCAGCAGCAGCAACAACAACAAATGCGTCGGCATCCTTGCAACGTGTCGCCTCGG
        AATCCAGTCTTGGTCGGGAGCGGGATCGGGAGCAAGCAGCTGCTCCACCTGGCCAACTGATGGGTCATCACTATCATTAC
        ATCCAATATCCGGCGCATTTCCAGCCGCAACAACTTCAGGAGCAGCCACCCCAGCCCCAACTGCCCTGCCAGTGTCCCTG
        CTCCTGCGGCCGTGCACCTCCACCGCCCATGCAGCCCACTAATCCCGGCCAGAATGCTTCAATGGCCGTGGCTGTGCTGG
        TCCACCAACAGACGCCCAGTCAGCAGGAGCCGGCAAGGAGTTCGCCGCTCAAAGCACAGTCCGCTCAGTCCCTGCTCAAT
        CACTCTTATCAGGCGCTGCACGAGGACCAGCATCAGCAGCAGGAGCAACTCCAGCTGGACTCCTCAGCCGGAGCCGGCAG
        TTGCGACTGCGATCTGGAGTGCACCTGCCCCGCCACTGGAGGAAACTCCTCCCTGGCCCAGCACAAGAGGAGCCTGCTGG
        CGGACGCCATGCTGGGAGCAGACGAGATTACGGTCAGCGAGTCCGACAACAACAGCACTATGATTAAAAAGAAGAAGCCC
        CGATCCGGCGGAGGAGCAGGACAACTACCGCCGAAGACACAGCCCACGAGCGACAGCTGCAATGACATCTACCATGATAC
        GGAGCTGGACGGAGCAGCAGGAGCTGGGACAGTTGGATCTCCTGGCTCCGGGATCAAGTCACAGATTCTGGACGATAATC
        ATCGCCCTCCTCTGCCGCCACGCCCACCGCCCAGACCCAGGAGTAATGCCAATGGCTCCATAGCCCATCGCCATGGCGCG
        GGGATCAAGAAGTACGTGGTCTGGTGCCTCATCTGCGGTGGATTCAGCTGCTTGCTGGGCGTGCTCTTCTTGGGCGTCTA
        CTTCCTGCTCCATTCGTACACCATCACGGTGGGCAACTTCGAAACGGTGCCCACCTTTGTGCCCGCCACCCTGCTCATCC
        TCACAGGAATCTGCATCATGAGCCTGGCCAGGCGTCGGAATCGCTATAGCTACCTGATAAAGCTGTCCGGAGCCTGTGGC
        CTGGTGTCCGCCTTAACCTGTGCTCTGGTCACAGTGACCACCACTGTGCTCCACATGAGTCGCCTGCAGGCCTTGAGGGA
        ATGCGAGTATGCTCAAAAGACGCGCACGTGCACCTGCTACTCGGACCTCATCGAATCCCAGGTGGACCGAGTGGATAAGG
        AAGGAGTGCGCCTTGTGTTCGACTCCCTCTCGGACTGCGGCGTTGTCCATGGATCCCTCTATTCCTGCCTGAGAGCTATC
        TTCGGCCTGTCCGTGGCCGGAGTGCTCATCGCCGTCTTCAGCTGCATGTTGGTGTACCAGCTACTCAGTCACGAACGCAA
        GAAGATGTACTGGGAGCAGCTGGAGCTGCGATGCAGATCCCTGTACGCCAGCCAGGCTCCTCCTCCGGCCTTGGGTCCAG
        GCAGGATGTTAAACTGCAGGTGCTGCGAGCAGTGCCACGCCCACAGGCAGTTGACACTGCCTTTGCAGGCCACCGCTTAT
        CCGTGGGACGAGGCCACGGTGGCCGCTGCAGCAGCAGCCGCAGGAGGAGGAGGCGGAGAGCAGCGGTTCTGGGCCGCCCA
        GCCGCCGGGTAACTTCTACTCGCCGAATCCAGGCGGCGATGATCCGGTGGGCACTTGCAGGAGTGGAGAACGGGCAGGAG
        GAGCAGGACGCAGTAGCAGCGGATGGAGCTGGCCTCGGATGCCCTGGCAACGTACCACTCCTGACGCCGGTCGTCGATTT
        CGCCAAGCTGCTGCCAGTCCGGATTCACAGTACGGATTTAGTTCGTCCACGGCGGTCCAGGGAGATGGTAACCAGATGCT
        GATCGAGGAACCCGTGGTGGCGGCCTACAGTGGAATGCCCCCGCCAAATGCCCTGCCCTACGGAGTTTGGGGACCGCCGC
        CACCCTACAGCGATCCCAACAGTCCGGCCAGACGTGGCTACTACCAGTATCTGCAGCCCACTGCGTGTCTGGTTGGGAAT
        CAGGGCACTGTCGCCGTCACTCTGACCCAGGAGCAAATGCATCCGACCCTGCAACATACGCATCCCCAACAGCAGCAGCA
        ATTGCAGCAGATGCAGCTGCAGCGGCTCCAGGTCCAGTCCGCCACCTTGGAGCGGATGGATGGGCTCAGCAGTGCCGGTA
        ACGTGAGTACCCTAGTGGCTGCCACTCGCTCCTCCGCCTACAAATCAAAGGCCGAGTACGAGAACACGCCGTCTGACAGT
        GATGGTGGCAATCCCCGGGAGAGGGAACGCTGCTCCAACACGCTGCCCACGCGAAAGCTGAAGAAGCGCTTGGAGGCGGG
        CACCGGGGCCAAGAGCATCGGTCCGCAGAGTAATCCTGGCCAGCAGCGACCCAATGTCCAGCAGTTGTTCGCCAAGCAGG
        ACCAACAGCAGCCCACCGGCCAGGCTAATCCCCAGCAGGCTCAGCCCCAGACGGCCGGGGTGGAGAACAGTGGCTACCAG
        GACTCGAACGGAGCCATAGCCAAGGACCAGGCGGTGGGAACGGATCCGGCCGAGTCCGAGGTGTACTTCGCCGACGTGAG
        TAGTTGCTGCAACATGTCTGTGAAGAATGACAGCTACTATGACAACGCCCAGCGCCACCAGGGGCACCACCATCATCACC
        AGCATCAGCACAGTAATTGCAGCCACAGCAGCGGGCAGAGCAACGCCAACGAGGACTACCTGGCCCAGCGCTTCGGTCGC
        GGCAGGGAGCACTCCGTTCGGAGTCGTCTGCCCATTCCGCAAACGAGGCGAGAGGACGACTACGAGAGCTCCAACCTGAA
        CATGCCCACGCTGAAGGAGCAGCAGCAGCAGGCGCAACAGCTGCAGAAGGAGATCTCCCGCCAGAGCATGTGCTCCGTGG
        AGTCGGAGGCCAAGACCGAGTTCACCGACCTCTCGCCCTCCACGCCCTGCGGTGGCAATCTGCCGTTGCCGCCGCCAGCG
        AATTTCGCCAGTGATCCGCCGACGGGTCAACAGTCGCCCAGCTTCGTGGCCTCGTTCCCCTACTCCTCGGAGTCGCAGTG
        CCTGGAGGCGCATCGTCGCTCCACAAAGAACATCCACGAGCTGATGATCTCCGGGGTGGGGGGATCCTCGACCGGCGGCG
        GCGACTCCCACTACGAGGTTATCAACGACCGGGGCAATCCCTACCAGCTGCAGCGATCGCAGCAGGCCAAGCACAAGGCC
        AAGTCCAAGACGCGGTCGCGGGAGCAGTTGGACATCTACGGCAGCGGAGCTGAGCGATCCGACTGGTCCTCGGATGGGGG
        TCGCTTGTGAGACCCCGATGACCAGGAGGTATTCGTCTAGCAGCGGTTTCACCCCCCTCGTATTCTCTAAGGATATTCTC
        TGTGGATCTGCTCGGGGAGCAGCGGTGGGACTCTCCACATCCGACTTCTTCTATATCATACGAACAAGCATCATTCGTAC
        ATCCAGGACAGCGCTGGACACCTCCCATCACTGCCTGTAGAACCACCTTTGGTTTAGAATCGTCGCACTTGTAATGTTTG
        CCATCCAAGAACGGAACTCTATTCTATTATATGTATGTCCTATCTCCCCAACTATCGAAAGTCCTCGGGGCTGCAAACCT
        TGCTTTAACTACTTTACGCGTATCCTTTGCATAGTTTACCTAGTACATATATTACTTATCACATATGGTAGCATTGAATT
        GAATGTTGACAACTTGTAGCAATGATAATCTATGGATATTATATACAAATTATGTTATATTTACCTGCGTATTTACATAG
        TTGCGTATACACACACCCATATACACATACAAATATATGACTAGTTAGTTAAATGTTAGAGCGCCAGTTAAATTTATTAA
        AGAGTACACCAAGTATAACCAAAATATTTTAAC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0303104
        3372
        FBtr0303105
        4270
        FBtr0310623
        3369
        FBtr0334072
        5090
        FBtr0474139
        4270
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0072656
        1120
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0292223
        873
        FBpp0292224
        1119
        FBpp0302743
        872
        FBpp0306197
        872
        FBpp0423138
        1129
        Comments
        Transcript terminates at site supported by polyadenylated cDNA.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG13921-RB
        Secondary FlyBase IDs
          References (2)