General Information
Symbol
Dmel\lov-RB
Species
D. melanogaster
Annotation Symbol
CG16778-RB
FlyBase ID
FBtr0072457
Feature type
Associated gene
Evidence Rank
Length (nt)
4458
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 19 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          AATTAGTCGCTTCGTGACGTTTGAACGGTTCAAAACATACACGCAACCCCCACATACGCTCATTCGTTACCCGCTACCCG
          TTAACCGATACGATGGTCAGCGGCCTTTTACAACGCCGCCGCCAATAATTTACCGTATTAGTTCGATTGATAAAGAATTG
          AAGCACGCTGCACGTGACTGGAACGGGGCATGTTAAAGGACGCCCACCAGAAGTTGATTAAACATCGCCAATCGACGAAG
          CTCTCCATGACCGACTTCGCTTGTCAGGCGGCGCCTGTAAAGCAGCCCCTGCCGCTAGAATTGCCGCTGCCTTTGTCAGT
          GCAGCTACAGCTTTTAGCAAAGACTCCGACCAGTGATCACGCCCCAATGCACTCTACGCCTCCGACGACCCCGCCTACGC
          CACCTCCTCTGCCCTTGAACATGAGTCAATCGGCATCGGCGGTAACGGAAGCTGCTACTCCAGAAAACAGTCTGCCTGCC
          ACACCACCCTCAGAAGGTGCACTAGCTGTACCATCGGCCCCACAGGATCACTACAGCCTACGCTGGAACAACCACCAGAA
          CCACATCCTGCGGGCATTCGATGCACTGCTGAAGACCAAAACGCTGGTGGACGTGACCCTGGTCTGCGCGGAGACTTCGA
          TCCGGGCTCACAAAATGGTGCTCTCCGCCTGTTCGCCCTTCTTCCAGCGCGTCTTTGCGGAAACTCCCTGCAAGCACCCA
          GTTATAGTGCTCAAGGATTTCCGGGGTTGGGTAGTGCAGGCCATTGTAGACTTTATGTACCGCGGAGAGATCAGCGTGCC
          CCAGCAGAGACTCCAGACACTCATCCAGGCCGGAGAGTCGCTTCAAGTCCGAGGCTTGGTGGAGAGCTCTGTCCCAGAAC
          ACACTCCCACACCGGCCGCTTCCCCCGATGATTTCGGGATGTTGGACACCTCTATGCTGTCCTCTACCTTTGAGGACGAG
          TGTCCGACGATGGTCCGACCCTCTAAGGGTGGAAAGCTTTTGATGCCGTCCGCCCGACTGTTTGGCAACGCTTCAAGCGC
          CATTGCTGCTCTAGGTTTGCGACGAAAACGAGAGCAGGAGTCCGACCGCGACTTGGAGAGTGATCAGGAGCTGGGAGGCA
          GTTCACCTATGCCACGACGTAAGCAAGCGCGACCGCGGCGCCGCTCCGGCGATGTGCCGCACGACTTTACCTTAAACAAA
          ACCGATGCAGAATCCTTGCAAACTGTGATCAAGCACGAGCTTCTAGAGCGAGCGGAAAGAGATCAGGAAGAGGCTCCTGA
          TCAAGATAACAGCCAAGGGGAAGCTGAAAAAATTAGTTCGTCGCCAGCAAAAACGTTGGTTGAACGGGCTAAGGAGCAAA
          AGTCCATGAAAGAAGAAGGATCCGATCAACCACGCAGTCTAAACGAGAATCACCATCAACTCGAGCTTGACGATGAGGAC
          GACGACGATCAGGATCATGAAGAGGAAGAGGAGCAAGACATTGAAGAGCTTATTCATACGACCAACGAGCTGAGGCGTCA
          GGCTGCAGCAGCTGCTGCAAATGCAGCCGCCATGTCTCCCAACCCTTCTCCCTGCCTCAGTGACGGGCCCGAGGACCTCT
          GCACCACTAAGAAAGGCAAGGAACTAATTTCTGGCCCCTCTAGTTCGGCAGACTGTGAGTCCAATAACAACAACAGCAGC
          AAGCTGCAGGACAACAACCAGCGCATAATGCTGTCTCTAAAGGACATCCGCCAACTAAACGCTAATCCGAACCCTACGGC
          CATCCACACGCCTACTAGCTGTTCTGGGGGCAACAACGGACTACTTACTTTCCCTCCGCCCGGACTTCGGCCTCCTGGTC
          TACCAGACAGCCCGCCCTGCCACATGGAAGCGCTAGAGGCACAGATGCACGCAGCTGCTGCTGCTGCCGTGGCGGCTGCT
          GGATCTGGGGAGCATCCCTTCCATCATATGGAGCACCAGATGGAGATGTCTTTGGCGGCTGCAGCGGCAGCTGCTGCGAT
          GCATCAGCGTGAGCCACGGGATCCCCGTGATGGGCGCGACCACAACGCATTTGCGAGCAATTTGCTGGGGCCAATGGGGA
          TGCCCCCGTTCGGAGGACATAACGGAGGCCATCCGGGCAACAGTGGTCCAGGAAACGGATGTCCTGGACAAGCTGCGCAC
          GAAAGACTTGAGGAGAGTATGAATCGACTGAGTAAGGAGCTTGGTAAGGAGTTTGGAAAGGAGTTTGGAAAGGAGTTTGG
          AAAGGAGTTTGGTCCGGCATCGCCAATGAGTCTGCAAGGTCCCTTCAATGCACCGGATGGACCCCCGCATCCGCCATCAC
          CATTGCCCTTTCCTGGCATGTCCTCTGCGATGACGCTGACTCCGCCACATATGTTTGGTCTCGACTCACCACTTGGACTC
          TTTCCACCCGGAATCGATCCTGGCAAGCTTTATAACCCGTTAATGGAAATGAGCGATCCAAGGGACATGCCTGGCGGGCC
          GCCTCCATTCCTTAAAAAGAAAATGCCGCGACCAAAGGGACAGCACTCAGCCCCACGCGGCGGTCCTCCACGCTCATGGA
          CTAACACAGAACTGACGGAGGCACTGCAGCACGTTTGGAACAAAAAGATGACCACGTCGCAGGCGTCGCGGATTTTCGGT
          ATCCCCTACAATTCTCTACTGATGTACGTCCGGGGAAAATACGGAAAGAGTTTAAAACTGGAGCAGCTGCGGAAGGACTG
          CATCAGTGGACCACCGATAGAAATGCTGCAAATGGGCATCGGCGGAGGTAGCGGTGGTTCCACGAAGAATGAGAAGAGCA
          AGGAGCGCAAGGAGAAGGAAAAGGACAAGAACTCCATGAGCAGCAACGGTTCGGGGGGGTCTGCTAATTCCCAAGGCGGA
          GCACCGACCTCCGGCAGTGGACCAATGCAGCATTCCGGTGAACTGGGGCCTATGGGACAGTTAGACCTGGATCTGGGACT
          TCCCCTGGGACCCCCAGGAGGACCCCGTAGTAACAGTTCCGAGCCCGATTTACTGAGTGCCCCAAATGCCCTGTTCAATC
          CCTTCAACCCACAGGGTTTCTACCCTGATTTTTCGGGCGGCTTTCCCGGCCTCCCTCTGAGCATGTTAAACCTTTTGCCG
          CCGGCAGAACGCCATCATGCAGCTGCGGCTATGCACCATCTTGGCGTGAGCATGGATGAGGACTGCAAGTCTGTTGGATC
          GAAGCAGTCCTCTTCCGTGGACGAAGACTACTCAGGTCCTGGAATACCGCTCTCGCTGGAGCACCGTCGGGAGATAAGCG
          CGACGGGCCCACCACTTACGCCATCCAACGGTGGGACCGGGCATGATTGAAACTTGTGGCGGGATTGGGCAGCCGGGGCT
          GCCAACGCCAATCCAATGTACTTCCCTGCTTTTGAGCTGGACCAGGAAATGAACCCTACCCCGCCGTCCCTGCCTTCGCG
          ACCCGCCCTTCACCAACTGGCTTGCCGTGAGCTCAGCTTTAAGCCAGACCTGTTCATGGCCAGAAGAAAGCTGAAACGCT
          TTCGGGACAAGCGTCAGCTCCAAGCGCAGATCGAGACGCCGACAGCAGCCGTTCCCGCTCCTTGTCCCGTAAGCAACGCG
          TTGCCACCGCTAAGGACTTAAAGGAAACTCTAATGCAATATGTCTACTATTAGTTGATAATTTCTTTTAATTAAGTAGCC
          CCAAAGGAATACATTTTGTGAGGACTAGGTGTTTTTTTCTTTAAGTAAATAATTTACTGGTGCTTTTAGTTCCTATTTCC
          AATCATTTATTTATATTTTTCAAATGATTTTAGTTAAATAAACGAATATGACAAAGCTTACAAAGCATTTGAGGCAATAT
          ATTAATATATAATTTTAGTTTCGAAAGGATTATAATCAAAATGAAGGAAGCTATAAAGAAGAACAAGTGTATATATGATA
          ATAGCCAAACTAACAAAAAGTTTGGAAGCAAGTTGAGGGAAAACCCAATGCAATTATAAGTATCGAAGGATACAAAGCCG
          ATGACTGTACCAAAATTTTTATGTTATCTAACAAATCAAATTGAAAAAATTTTTAGTATAATTAAGTGTTCTCGTAGGCA
          ATTCGTATTTGTATAGAAAACATTTGCACAAATATTCCTCATTCATAGTTGTGCACGTTCCCCTTACATAACAGGCAAGT
          TCGTAGTTATTCCTAAATGCAGCTTTGTAAATCTCAGCAAATAATGGAACCCTGCAGATTTACCCGTTCGTAATCTCATT
          TGTATAGTAAGCAACCAAACCTAAACCAACCTATAAAGAGGCATAAAAGTGAGACCTTCCCACGCATAGTGTTAATACTT
          TGTAAGCTCAACATATTTTAATATTTAATATTTCAACAGAAACGTATGTAAGTGAAATAAAATTAAAACGTATACATTAA
          AATAAATAGTACAAGTTATTAAATAAAACGTTTTTCTTTTATGAATAGTTTTCATAGG
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0072458
          4497
          FBtr0100126
          4712
          FBtr0330231
          3826
          FBtr0343605
          4185
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0072359
          1046
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0072360
          1046
          FBpp0099472
          1046
          FBpp0303264
          1143
          FBpp0310200
          1046
          Comments
          Extended 3' UTR based on RNA-Seq and/or EST data.
          Corresponds to transcript B in FBrf0221418.
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (3)
          Reported As
          Symbol Synonym
          CG16778-RB
          lov-RB
          Secondary FlyBase IDs
            References (2)