General Information
Symbol
Dmel\Moe-RF
Species
D. melanogaster
Annotation Symbol
CG10701-RF
FlyBase ID
FBtr0071274
Feature type
Associated gene
Evidence Rank
Length (nt)
2919
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 184 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      TCATTCGTGTTGCGATTTGCTTAACGACGGAACTCATTTTTTTTACGTGTGTGTGCAAAAATAAAACTAAAAGGAAAACC
      TACGAAAAAGGCAGGAAAATAATAAAAACACAAGTTTTTCTTTTGCCGGCAAGCAAAAACAATAAGTGCTCTGCATGCGT
      GTATTGCAGCACAAAAACAATAAAGAGTTCAGACGATAATATCCTGGAAAGAAAACATTTCGTTTCGATAAGTACGACAA
      GACACGAAACAACAAAATGTCTCCAAAAGCGCTAAATGTGCGCGTCACGACAATGGACGCGGAACTGGAGTTCGCCATTC
      AGTCGACGACGACGGGCAAGCAATTGTTTGACCAGGTGGTGAAGACGATCGGCCTGCGAGAGGTTTGGTTCTTTGGACTC
      CAGTACACCGACTCCAAGGGCGACTCCACATGGATCAAGCTGTACAAAAAGGTGATGAACCAGGACGTGAAGAAGGAGAA
      TCCCTTGCAGTTTAGGTTCCGTGCCAAATTCTATCCCGAGGATGTGGCCGAGGAGCTGATCCAGGACATTACACTGCGTC
      TGTTCTACCTGCAGGTGAAGAATGCCATACTGACCGACGAGATCTATTGTCCGCCAGAGACATCCGTGCTGCTCGCCTCG
      TACGCCGTCCAGGCGCGTCATGGTGACCACAATAAGACCACCCACACAGCCGGCTTTCTGGCCAACGATCGCCTGCTGCC
      GCAGCGCGTCATCGACCAGCACAAGATGTCCAAGGACGAGTGGGAGCAGTCGATTATGACCTGGTGGCAGGAGCATCGCA
      GCATGCTGCGCGAGGATGCCATGATGGAGTATCTGAAGATCGCCCAAGACCTGGAGATGTACGGCGTTAACTACTTTGAG
      ATCCGCAACAAGAAGGGCACGGATCTTTGGCTGGGCGTAGACGCACTGGGTCTGAACATTTACGAGCAGGACGATAGGTT
      GACGCCGAAAATTGGTTTCCCATGGTCCGAGATTCGCAACATTTCGTTCTCGGAGAAGAAGTTCATCATCAAGCCGATCG
      ACAAGAAGGCTCCGGACTTTATGTTCTTTGCGCCACGTGTCCGCATCAACAAGCGCATTCTGGCCCTCTGCATGGGCAAC
      CACGAGCTGTACATGCGTCGCCGCAAGCCGGACACCATCGATGTGCAGCAGATGAAGGCGCAGGCGCGCGAGGAGAAGAA
      TGCCAAACAGCAGGAACGTGAGAAGCTGCAGCTGGCGCTGGCCGCACGCGAACGCGCTGAAAAGAAGCAGCAGGAGTACG
      AGGATCGGCTAAAGCAGATGCAGGAGGACATGGAGCGTTCGCAGCGCGATCTGCTTGAGGCGCAGGACATGATCCGCCGG
      CTGGAGGAGCAGCTGAAGCAGCTGCAGGCCGCCAAGGATGAGCTGGAGCTGCGCCAGAAGGAGCTGCAGGCGATGCTGCA
      GCGCCTCGAGGAGGCCAAGAATATGGAGGCCGTCGAGAAGCTCAAGCTCGAGGAGGAGATCATGGCCAAGCAGATGGAGG
      TGCAGCGCATTCAGGACGAGGTCAACGCCAAGGATGAGGAGACAAAGCGTCTGCAGGACGAAGTGGAAGACGCCCGACGC
      AAGCAGGCTGAAGCCGCTGCCGCTCTGCTGGCCGCGTCGACAACGCCGCAGCATCACCACGTGGCCGAGGATGAGAACGA
      GAACGAGGAGGAGCTGACGAACGGCGATGCCGGTGGCGATGTGTCGCGCGACCTGGACACCGACGAGCATATCAAGGACC
      CCATCGAGGACAGACGCACGCTGGCCGAGCGCAACGAACGCTTGCACGATCAGCTCAAGGCTCTGAAACAAGATTTGGCG
      CAGTCTCGCGACGAGACGAAAGAGACGGCAAACGATAAGATTCATCGCGAGAACGTTCGCCAGGGACGTGACAAGTACAA
      GACGCTCCGCGAGATTCGTAAGGGCAACACAAAGCGTCGCGTCGATCAGTTTGAGAACATGTAAAAGCTATCAAAGATCA
      GAGATCGATAGTGCGCGGGAAAGAGAGAGGGAGCGGTGAGACTCCAGAAAGAAAAAGAAAAAGATATAACTACAGCAAGA
      GCAGATAATAATAATGATGATTGATAATGATGAAGATGATGATGAAGAATAAGCAACAAATATAATTCCGGTCGCTGGCA
      AAAGCCTATTGCTAACTATCCCACCAGCGACGACCCTTTTCCACCCATAAGAACACTTCCTGCCTCCTAAAGTGAATTGA
      AATGAAATATACTTTGTTTGACCGTCGTTTTGTCTCGCAGCTTTTGTATAGAAGAATCAAGAATAAGCAAAAAGAAAAAA
      AGAAAAAATAAATTAATGGAAACTAATTTAGCCGGACACAGCACTCATCAATATGAATAGAATGAGAAGACGGTTAGGAA
      GGACCGCATCTATATGGACAATCAGCAAATGAATGAGGATCAAGCTATCGGAAAATATGTCTAAATCCAAGCAGAAGCAA
      TAGAAAATATACATTTCTCCTTTTCCCAATGGATTCATTGAGAAAACGGAACGAATAGTAATAGATATTGAAAAGGAACA
      TCAGCAACAATAAACAACAACAACATCAACAACAACAAGAACAGCTACTACAACAAAACAAACAACTATTTGCATTTTCC
      CCCGTTATAATTATTATTTTTATTATTATATAATTACTATTTTTTTTAAATTTGTATAATTAAATAAGAACTTGATTAAT
      TGTTTCTTAAATTAACTTGAGAGAGAGCAACAAACAAAAAGAGAAAAAATATATTATATAAAATATTTTTCTTTAATCTA
      TTTTTGTTTTGCAAGAAAAGAAAGATTCTTAAAAAAAATGAGAAAACAAACAACAAAAAACTATTGTGAAAAAACCAAAC
      AAAAAGTTTTTAAATTAAACAATAAAAATGTAAAACAAC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0071271
      2353
      FBtr0071270
      2462
      FBtr0071272
      2027
      FBtr0071269
      3003
      FBtr0071273
      2283
      FBtr0071275
      2295
      FBtr0071276
      2236
      FBtr0071277
      2282
      FBtr0071278
      2401
      FBtr0308193
      3064
      FBtr0308194
      2528
      FBtr0331601
      2995
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0089232
      575
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0071214
      640
      FBpp0071213
      649
      FBpp0071215
      512
      FBpp0071212
      575
      FBpp0089231
      575
      FBpp0089233
      575
      FBpp0089234
      575
      FBpp0089235
      575
      FBpp0089236
      578
      FBpp0300513
      646
      FBpp0300514
      578
      FBpp0303991
      584
      Comments
      Transcript terminates at site supported by polyadenylated cDNA.
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG10701-RF
      Secondary FlyBase IDs
        References (2)