General Information
Symbol
Dmel\HIP-RA
Species
D. melanogaster
Annotation Symbol
CG32789-RA
FlyBase ID
FBtr0070600
Feature type
Associated gene
Evidence Rank
Length (nt)
2050
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 121 )
Sequence
ATACCAATCGATAGGGCAGAGCAAAAGTGGACGTAAAGCTAAGCAAATATTGCAGGACATCAGATCTGAAAACATCAAGA
CAAAACGGAATTCAGAAATGGCTTTCACAATGCAAACCGGGGATCTGAAGAAGCTGAAGTACTTCATCGACTTTGCGCTT
GAGAATCCCACCTTCTTGAACATGCCGCAGCTGCAGTTCGTCAAAGATTTCGTGGAGAAGTTTGGTGGCACGGTGCCGCC
TGGCCAATTCAACGGTGGCAGCGCCGGAGGCAAGTGCCCATTCGGCGGTGTTGCTGGTGCCAAGGCCAACGAGCCGGCCA
ATGCCCCCGAGGATAGCGAGGACGAAAAGTCCCTCTCCGATCCTGAGTCGGACGTGGAGCTGGACATGGAGGGTGTGATC
GAGGCGGACAGCGACCCCGCCCAACCCATGGGCAACTACAGCAAGAAGGCCACCGAAGAGGAGGTGGAGCAGGCGAGCGA
GCTGCGCGCCCAGGCGGCCTCCGCTTACGGCCAGCAGAAGTTCGACGAGGCCATCGCCTTGTACACCAAGGCCATTGAAC
TGAGCCCGGGTAATGCCCTTTTCCACGCTAAGCGTGGTCAGGCCTTCCTCAAGCTGAAGAAGCCGAATGCCTGCATTCGG
GACTGCGACGTGGCGCTGGAACTCAACTCGGATTTGGCGGCTGGCTACAAGTTCAGGGGACGCGCCCGTCGCCTCCTCGG
AGATTTTGAGCTGGCTGCCCATGATTTGCGCCAAGCATGCAAGCTGGACTTTGACGAGGAGACAGACGAGTGGCTAAAGG
AGGTCACTCCGAATGCCAAGAAAATCGAGCAGCATCGCTTGAAGCAGGAGCGTCGCCAGGCAGAGCGTAAGATCAAGGAA
CGCCAGCGGGATCAGAGGCGCGCACGTAAGGAGCAGGAAAAGCACAATGCCAGCTCTGGTGGATCATCTGGAGAATTTTC
CGGTGGGAATCCTGGTAACGGAAATATGTCTGATATACTGGGCGCCATGTCAGATCCCGAGGTGTCAGCCGCCATTCAGG
ACATTTTGTCAAATCCGGGTAACATCACAAAGTACGCGTCGAACCCGAAGATATACAACCTTATCAAGAAGATTGTGCCC
GGTGGAGATGTGGGTGCTGCCTTTGGCCAAGCGGGTGAAAAGGCTGGAAAGCCGAGCGAGCCTAAGCCTAAAAAGGATTC
CGCCGACTTCGTCGATGACGGTTTGGACTAAGGTTTAGAAATGGGGCAGTAGTAAGACTGAAACATGCGTCGATAAAAAG
AAGTTAACAAACAATTACACGAAATCGAGCGAGATTACAAAACAACAAAGAAAGAGAAAGCAACAGAGTGCGGGGAAGAA
GATGGACTACACGAAAAACAAAAGGGAAAGCAACTGCCTTACACATTTTTGCAGCTGGGAAAAAACAAACATTTCCTAAG
CTTTAACTTAACCAACACGTAAAAGAACGGGCGACAATGGAGAAAATTCAAATATTCAAAATACTACAAGCAGTCAGAAG
AATAAGCAACATTTATTTAAATCGAGAAGAAAGAGATGTTGGAGATGCTGGAGACGCTTCTTCACATATTATTGAAAAGC
ATACTTGCGGCCATTAAAGTGGCAAATGAAACTATACAAAGGAGCTAGAATATGCTTAAAAACTTCACATTTGCAGTTCA
CAGGTAAATCAAAAGATTGTCCTGTAACGAACAAAACATGAATGTTTAGACGTCAAGTCAGATTCAAGGGTGCCGATCGA
TCTAGTTGAACTAAAGCTCGAGAAACAACCAAAAGAAAATAAAAAATATATATATGTTCAATAATATTAGCCTAAATTAC
CGAGAACGAAGAAACGGATAAAACTAATCGCATCATTTGGTCAAACAAAATTGTACTGAGTAGGATTTAAATCATATTGT
ATGCAAATGCATTTAGCCCCCCAACATGAAAGCAATCGCCCATTCATTCACACACTCATTCACACACTCATTCACACACT
CATTCAACCAGTGATCAATGGAAATAAATAAACGAATCAACAAGAACCCG
Other Products of this Gene
Other Transcripts
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0070575
377
Derived from OTHER transcripts
Comments
Transcript terminates at site supported by polyadenylated cDNA.
External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG32789-RA
HIP-RA
Secondary FlyBase IDs
    References (2)